ID: 942226590

View in Genome Browser
Species Human (GRCh38)
Location 2:173822062-173822084
Sequence TGCCCTCTTAAAGTAGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942226590_942226596 -2 Left 942226590 2:173822062-173822084 CCTCCATCTACTTTAAGAGGGCA No data
Right 942226596 2:173822083-173822105 CATGACCATGGGACCTGGGCTGG No data
942226590_942226594 -7 Left 942226590 2:173822062-173822084 CCTCCATCTACTTTAAGAGGGCA No data
Right 942226594 2:173822078-173822100 GAGGGCATGACCATGGGACCTGG No data
942226590_942226599 15 Left 942226590 2:173822062-173822084 CCTCCATCTACTTTAAGAGGGCA No data
Right 942226599 2:173822100-173822122 GGCTGGACCAAGACAATGCCTGG No data
942226590_942226595 -6 Left 942226590 2:173822062-173822084 CCTCCATCTACTTTAAGAGGGCA No data
Right 942226595 2:173822079-173822101 AGGGCATGACCATGGGACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942226590 Original CRISPR TGCCCTCTTAAAGTAGATGG AGG (reversed) Intergenic
No off target data available for this crispr