ID: 942234580

View in Genome Browser
Species Human (GRCh38)
Location 2:173891508-173891530
Sequence TAGATAAGGCAGCCACATAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942234576_942234580 4 Left 942234576 2:173891481-173891503 CCAAAGACATAACACAGGTGTTA No data
Right 942234580 2:173891508-173891530 TAGATAAGGCAGCCACATAGGGG No data
942234572_942234580 28 Left 942234572 2:173891457-173891479 CCTTGGTTTTTTCTTCCAGTTTT No data
Right 942234580 2:173891508-173891530 TAGATAAGGCAGCCACATAGGGG No data
942234573_942234580 13 Left 942234573 2:173891472-173891494 CCAGTTTTCCCAAAGACATAACA No data
Right 942234580 2:173891508-173891530 TAGATAAGGCAGCCACATAGGGG No data
942234575_942234580 5 Left 942234575 2:173891480-173891502 CCCAAAGACATAACACAGGTGTT No data
Right 942234580 2:173891508-173891530 TAGATAAGGCAGCCACATAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942234580 Original CRISPR TAGATAAGGCAGCCACATAG GGG Intergenic
No off target data available for this crispr