ID: 942239158 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:173943105-173943127 |
| Sequence | CAGAGTAAGCATAAGGCTGA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 942239158_942239163 | -6 | Left | 942239158 | 2:173943105-173943127 | CCATCAGCCTTATGCTTACTCTG | No data | ||
| Right | 942239163 | 2:173943122-173943144 | ACTCTGAGGCAGGGACCTGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 942239158 | Original CRISPR | CAGAGTAAGCATAAGGCTGA TGG (reversed) | Intronic | ||
| No off target data available for this crispr | |||||