ID: 942239158

View in Genome Browser
Species Human (GRCh38)
Location 2:173943105-173943127
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942239158_942239163 -6 Left 942239158 2:173943105-173943127 CCATCAGCCTTATGCTTACTCTG No data
Right 942239163 2:173943122-173943144 ACTCTGAGGCAGGGACCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942239158 Original CRISPR CAGAGTAAGCATAAGGCTGA TGG (reversed) Intronic
No off target data available for this crispr