ID: 942239401

View in Genome Browser
Species Human (GRCh38)
Location 2:173945852-173945874
Sequence GGATTAAGGCATGAGCCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942239401_942239406 1 Left 942239401 2:173945852-173945874 CCTGGTGGCTCATGCCTTAATCC No data
Right 942239406 2:173945876-173945898 AGCACTTTACGAGGCTGATGTGG No data
942239401_942239403 -8 Left 942239401 2:173945852-173945874 CCTGGTGGCTCATGCCTTAATCC No data
Right 942239403 2:173945867-173945889 CTTAATCCCAGCACTTTACGAGG No data
942239401_942239408 16 Left 942239401 2:173945852-173945874 CCTGGTGGCTCATGCCTTAATCC No data
Right 942239408 2:173945891-173945913 TGATGTGGACGGATCATTTGAGG No data
942239401_942239409 21 Left 942239401 2:173945852-173945874 CCTGGTGGCTCATGCCTTAATCC No data
Right 942239409 2:173945896-173945918 TGGACGGATCATTTGAGGTCAGG 0: 19
1: 530
2: 6701
3: 34319
4: 89073
942239401_942239407 5 Left 942239401 2:173945852-173945874 CCTGGTGGCTCATGCCTTAATCC No data
Right 942239407 2:173945880-173945902 CTTTACGAGGCTGATGTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942239401 Original CRISPR GGATTAAGGCATGAGCCACC AGG (reversed) Intronic
No off target data available for this crispr