ID: 942239855

View in Genome Browser
Species Human (GRCh38)
Location 2:173951673-173951695
Sequence ATTCAAAGAAAACCCACAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942239855_942239859 29 Left 942239855 2:173951673-173951695 CCAATTGTGGGTTTTCTTTGAAT No data
Right 942239859 2:173951725-173951747 CTTCAAGTTCAGTCCAAATGTGG No data
942239855_942239856 -3 Left 942239855 2:173951673-173951695 CCAATTGTGGGTTTTCTTTGAAT No data
Right 942239856 2:173951693-173951715 AATACTACACCAAACTTAACAGG No data
942239855_942239857 0 Left 942239855 2:173951673-173951695 CCAATTGTGGGTTTTCTTTGAAT No data
Right 942239857 2:173951696-173951718 ACTACACCAAACTTAACAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942239855 Original CRISPR ATTCAAAGAAAACCCACAAT TGG (reversed) Intronic