ID: 942239858

View in Genome Browser
Species Human (GRCh38)
Location 2:173951702-173951724
Sequence AAACTGCCACCTGTTAAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942239858_942239859 0 Left 942239858 2:173951702-173951724 CCAAACTTAACAGGTGGCAGTTT No data
Right 942239859 2:173951725-173951747 CTTCAAGTTCAGTCCAAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942239858 Original CRISPR AAACTGCCACCTGTTAAGTT TGG (reversed) Intronic