ID: 942241043

View in Genome Browser
Species Human (GRCh38)
Location 2:173964490-173964512
Sequence GACGTGGATAGCGGCGGCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 124}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942241043_942241055 16 Left 942241043 2:173964490-173964512 CCGCCGCCGCCGCTATCCACGTC 0: 1
1: 0
2: 0
3: 13
4: 124
Right 942241055 2:173964529-173964551 TCTTGTTTCACGGGCTTTTCGGG 0: 1
1: 0
2: 0
3: 8
4: 135
942241043_942241056 25 Left 942241043 2:173964490-173964512 CCGCCGCCGCCGCTATCCACGTC 0: 1
1: 0
2: 0
3: 13
4: 124
Right 942241056 2:173964538-173964560 ACGGGCTTTTCGGGAGCTGCAGG 0: 1
1: 0
2: 0
3: 6
4: 56
942241043_942241050 6 Left 942241043 2:173964490-173964512 CCGCCGCCGCCGCTATCCACGTC 0: 1
1: 0
2: 0
3: 13
4: 124
Right 942241050 2:173964519-173964541 AGCCATTTCCTCTTGTTTCACGG 0: 1
1: 0
2: 0
3: 36
4: 310
942241043_942241051 7 Left 942241043 2:173964490-173964512 CCGCCGCCGCCGCTATCCACGTC 0: 1
1: 0
2: 0
3: 13
4: 124
Right 942241051 2:173964520-173964542 GCCATTTCCTCTTGTTTCACGGG 0: 1
1: 0
2: 2
3: 24
4: 236
942241043_942241054 15 Left 942241043 2:173964490-173964512 CCGCCGCCGCCGCTATCCACGTC 0: 1
1: 0
2: 0
3: 13
4: 124
Right 942241054 2:173964528-173964550 CTCTTGTTTCACGGGCTTTTCGG 0: 1
1: 0
2: 0
3: 9
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942241043 Original CRISPR GACGTGGATAGCGGCGGCGG CGG (reversed) Exonic
900214063 1:1471855-1471877 GGCGGCGGTAGCGGCGGCGGCGG + Exonic
900221612 1:1512239-1512261 GGCGGCGGTAGCGGCGGCGGCGG + Exonic
901443427 1:9293033-9293055 GCCTTGGAGAGCAGCGGCGGCGG + Exonic
903174918 1:21575035-21575057 GAGGTGGGAAGCGGGGGCGGAGG + Intronic
906640506 1:47438217-47438239 GACGTGGTGGGCGGCGGCAGCGG + Exonic
911696561 1:100895993-100896015 GGCGTGGCTTGCGGCGGGGGCGG - Exonic
912993464 1:114511030-114511052 GAGGCTGAGAGCGGCGGCGGGGG - Exonic
924362357 1:243254969-243254991 GATGTGGAAAGCAGCCGCGGCGG + Intronic
924713928 1:246554725-246554747 TACGTGGATGGCGGCGGGGATGG - Intronic
1064443184 10:15371311-15371333 GGCGCGGGCAGCGGCGGCGGCGG - Intergenic
1065214955 10:23439764-23439786 GACGTGTAGTGCGGCGGCAGCGG - Exonic
1074169679 10:110919830-110919852 AACCAGGAAAGCGGCGGCGGCGG - Intronic
1076314114 10:129528672-129528694 GCCGTGGAGAGCTGCGGTGGTGG + Intronic
1076868900 10:133183092-133183114 GACGTGGGTGGCGGCAGGGGCGG + Intronic
1083033492 11:59615499-59615521 GACGGTGGTCGCGGCGGCGGCGG - Exonic
1083644748 11:64165787-64165809 GGCGTGGGGGGCGGCGGCGGTGG - Exonic
1084086359 11:66857090-66857112 GGCGCGGTTAGCGGTGGCGGCGG - Intronic
1084310229 11:68312517-68312539 GGCGCGGGTGGCGGCGGCGGGGG + Intergenic
1085395779 11:76206504-76206526 GCCGGGGAGAGCGGAGGCGGCGG + Exonic
1087218895 11:95524437-95524459 GATGTTGATAGTGGGGGCGGGGG - Intergenic
1089279431 11:117362740-117362762 GAAATGAATAGTGGCGGCGGGGG - Intronic
1096749951 12:53752164-53752186 GGCCTGGAAGGCGGCGGCGGCGG - Intergenic
1096818819 12:54218120-54218142 GACGTGAACAGCCGCGGCGGAGG - Intergenic
1097264617 12:57738143-57738165 GACGGAGAAGGCGGCGGCGGAGG + Exonic
1100391438 12:94148881-94148903 GACGCGGGCGGCGGCGGCGGCGG - Exonic
1102913764 12:116737910-116737932 GACGTGGGGCGCGGCGGCCGGGG + Exonic
1112216249 13:97434091-97434113 GCTGGGGGTAGCGGCGGCGGCGG + Intergenic
1117176628 14:53152764-53152786 GAGGGTGAGAGCGGCGGCGGCGG - Exonic
1117478260 14:56118600-56118622 GGCGGGGATCGCGGCGGAGGCGG + Exonic
1119003981 14:70907801-70907823 GGCGGGGACGGCGGCGGCGGCGG + Exonic
1120167900 14:81220346-81220368 GAGGCGGGAAGCGGCGGCGGCGG + Intronic
1121201436 14:92121589-92121611 GACGAGGATCACGGCGACGGTGG - Intronic
1121279387 14:92688184-92688206 GACGGTGGTGGCGGCGGCGGCGG + Exonic
1122275156 14:100587316-100587338 GGCGGCGGTAGCGGCGGCGGCGG - Intronic
1122517621 14:102319799-102319821 AGCGAGGATGGCGGCGGCGGCGG + Exonic
1123001927 14:105300481-105300503 TTCGTGGAGAGCAGCGGCGGCGG - Exonic
1202929089 14_KI270725v1_random:23139-23161 GAGGCGGACAGCGGCGGCGAGGG - Intergenic
1123396609 15:19943895-19943917 GGCGGGGAAAGCGGCGGCGGGGG - Intergenic
1128028572 15:64460582-64460604 GTCCCGGATCGCGGCGGCGGCGG + Intergenic
1129299241 15:74615921-74615943 GGCGGCGACAGCGGCGGCGGCGG + Intronic
1130348051 15:83067057-83067079 GACGGTGAGGGCGGCGGCGGCGG + Exonic
1130924570 15:88375406-88375428 GAGGTGGATAGTGGGGGAGGAGG - Intergenic
1132893225 16:2214762-2214784 GGCGGCGATGGCGGCGGCGGAGG - Exonic
1134164046 16:11915900-11915922 GACGACGACAGAGGCGGCGGCGG + Exonic
1140091939 16:71846026-71846048 GCCGGGGATGGCGGCGGCCGCGG + Exonic
1143548576 17:7614766-7614788 GACGAAGGCAGCGGCGGCGGCGG - Exonic
1143712709 17:8745172-8745194 GAGGTGCTTAGCGGCGGCAGGGG + Intronic
1143747599 17:9005107-9005129 GACGTGGAGAGATGCGGGGGAGG - Intergenic
1144345622 17:14346535-14346557 GATGTGGATAGCGGGCGCAGTGG - Exonic
1144828803 17:18120826-18120848 GCCGGGGAGAGCGGCGGCGCGGG - Exonic
1146339609 17:32007676-32007698 GACGTGGGCGGCGGCGGCGGCGG - Intergenic
1148178077 17:45584874-45584896 GACGTGGGCAGCGGCAGCGGCGG + Intergenic
1148337618 17:46851953-46851975 GATGAGGAGAGCGGCGGCTGGGG - Intronic
1148786835 17:50149729-50149751 GACGGGGCGGGCGGCGGCGGCGG + Exonic
1150407973 17:64919164-64919186 GACGTGGGCGGCGGCGGCGGCGG + Intronic
1150643448 17:66964573-66964595 GACCCGGAGCGCGGCGGCGGCGG + Intergenic
1150747248 17:67825800-67825822 GACGTGGGCGGCGGCGGCGGTGG - Exonic
1150791895 17:68205762-68205784 GACTTGGGCGGCGGCGGCGGCGG - Intergenic
1153805386 18:8705597-8705619 GACGACGACGGCGGCGGCGGCGG - Intergenic
1155507844 18:26549208-26549230 GATGGGGCTGGCGGCGGCGGCGG + Exonic
1156446936 18:37243898-37243920 GGCGAGGATGACGGCGGCGGCGG + Exonic
1160507653 18:79436502-79436524 GACGGGGATACCGGGCGCGGGGG - Intronic
1160536970 18:79599873-79599895 GACGTGGCTTGTGGCGGCCGTGG - Intergenic
1161620111 19:5293189-5293211 GACGCGGGGAGCGGCTGCGGCGG - Intronic
1163554032 19:17982622-17982644 GTCGGGGATGGCGGCAGCGGTGG - Intronic
1164658554 19:29942390-29942412 GACGCGAACAGCAGCGGCGGCGG + Exonic
1167007908 19:46787474-46787496 GGCGTTGATGGCGGCGGAGGCGG + Exonic
1167019231 19:46861457-46861479 GTCGGGGATGGGGGCGGCGGCGG - Intergenic
1167056139 19:47112541-47112563 GACTCTGATGGCGGCGGCGGGGG + Exonic
1167081040 19:47276140-47276162 AGAGTGGATGGCGGCGGCGGTGG + Intergenic
1168281606 19:55308821-55308843 GGCGTGGGTGGCGGGGGCGGTGG + Intronic
927472732 2:23387043-23387065 GGCGGGGATGGCAGCGGCGGCGG - Intronic
929188601 2:39120444-39120466 GGCGGGGAGAGGGGCGGCGGCGG + Exonic
931274866 2:60735734-60735756 GACGAGGGGAGCGGCGGCCGCGG + Intergenic
931355837 2:61537472-61537494 GGCGTGGGGCGCGGCGGCGGCGG - Intronic
932416001 2:71574290-71574312 GACGGCGCCAGCGGCGGCGGCGG - Exonic
932827927 2:74958673-74958695 GGCCGGGATGGCGGCGGCGGCGG + Exonic
934567042 2:95346837-95346859 CCCGTGGAGGGCGGCGGCGGCGG - Intronic
934746149 2:96760962-96760984 GGCGCGGGGAGCGGCGGCGGCGG + Exonic
935592554 2:104855604-104855626 GGCGGGGGTGGCGGCGGCGGCGG + Exonic
936104951 2:109615246-109615268 GAGGAGGAGAGCAGCGGCGGAGG + Exonic
941666426 2:168247548-168247570 GGCGGGGACGGCGGCGGCGGCGG - Exonic
942241043 2:173964490-173964512 GACGTGGATAGCGGCGGCGGCGG - Exonic
948910262 2:240999130-240999152 CAAGTGGCTGGCGGCGGCGGCGG - Intronic
1168753134 20:297773-297795 GAGGAGGAAAGCGGCGGCGGTGG + Exonic
1172587287 20:36093512-36093534 GCGGTGGGTGGCGGCGGCGGGGG + Intronic
1175862214 20:62156559-62156581 GTCGTGGAGACCGGCGGAGGAGG + Intronic
1176178877 20:63740466-63740488 GACGTGGACGGGGGCGGCGGCGG + Exonic
1179674891 21:42974692-42974714 GGCGGCGAGAGCGGCGGCGGCGG - Intronic
1180801574 22:18634443-18634465 GGCGGGGACGGCGGCGGCGGCGG - Intergenic
1181220148 22:21360818-21360840 GGCGGGGACGGCGGCGGCGGCGG + Intergenic
1182299993 22:29331883-29331905 GACCTGGAGGGGGGCGGCGGGGG + Exonic
1184347754 22:43923898-43923920 GTCGTACATGGCGGCGGCGGCGG - Exonic
1184412250 22:44331946-44331968 GAAGTGGGCAGCGGCGGCGGCGG - Intergenic
952889264 3:38029859-38029881 CCCGTGGGTGGCGGCGGCGGAGG - Intergenic
962919135 3:139935420-139935442 GGCGTGGGGAGCGGCAGCGGCGG + Exonic
965757220 3:172039644-172039666 GAGGAGGAGAGCGGCGGCGGCGG + Intronic
966866544 3:184261519-184261541 GGCGGGGGTGGCGGCGGCGGCGG + Intronic
970456225 4:16226561-16226583 GCCGCGGATGGCGGCGGCGGCGG - Intronic
970585667 4:17512039-17512061 GAGCAGGATGGCGGCGGCGGCGG - Exonic
978282344 4:107034205-107034227 GCTGTGGACAGGGGCGGCGGAGG + Intronic
978576698 4:110196726-110196748 GGCGTGGCTGGTGGCGGCGGTGG - Intronic
981044585 4:140253253-140253275 GGGGTGGAAGGCGGCGGCGGCGG + Intergenic
990825460 5:59893429-59893451 GGCGAGGGTGGCGGCGGCGGGGG + Exonic
994072826 5:95620849-95620871 GACGTTGGCGGCGGCGGCGGCGG - Exonic
1001065123 5:168529715-168529737 GGCAAGGATCGCGGCGGCGGTGG + Exonic
1002090113 5:176799281-176799303 GACGTGGATGGCGATGGTGGAGG + Intergenic
1003603807 6:7542000-7542022 GAGGTGACCAGCGGCGGCGGGGG + Exonic
1006076281 6:31534690-31534712 GCGGTGGATGGCGGCAGCGGAGG - Intronic
1013641531 6:112087544-112087566 GACGTGCTTAGCGACGGCAGAGG - Intergenic
1014137710 6:117907817-117907839 GCCGAGGGCAGCGGCGGCGGCGG + Exonic
1018613397 6:165663270-165663292 GGCGCGGAAGGCGGCGGCGGCGG - Intronic
1019474150 7:1236081-1236103 GACAGCGACAGCGGCGGCGGCGG + Exonic
1019664051 7:2242419-2242441 GACGAGGAGAGCGGGGCCGGGGG + Intronic
1019919130 7:4151620-4151642 GACGAGGATGGCGGTGGTGGTGG - Intronic
1021614393 7:22487554-22487576 GCCGAGGATGGCGGGGGCGGGGG + Intronic
1028540849 7:91940875-91940897 GACGAAGATGGCGGCGGCGGCGG + Exonic
1029537110 7:101163335-101163357 GACGTGGGTGGGGGCGGGGGCGG + Exonic
1034483540 7:151341734-151341756 GAAGGCGACAGCGGCGGCGGGGG + Exonic
1035206934 7:157299987-157300009 GACGTGGAGGGCGGCGCCGCCGG - Intergenic
1035297191 7:157873844-157873866 GAGGTGGAAAGCGGAGGAGGAGG + Intronic
1035460629 7:159036461-159036483 GAAGTGGGTAGAGGCGGAGGAGG + Intronic
1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG + Exonic
1038644309 8:29350193-29350215 GACGAGAATGGCGGCGGCGCGGG - Exonic
1038828620 8:31033348-31033370 GGCGGGGAGAGCGACGGCGGGGG + Exonic
1039531799 8:38269178-38269200 GATGGGGAAGGCGGCGGCGGCGG - Exonic
1039996746 8:42541301-42541323 GGCGGGGCTCGCGGCGGCGGCGG - Intronic
1041280997 8:56211311-56211333 GACGTCGGCGGCGGCGGCGGCGG - Intronic
1047024559 8:120811822-120811844 GATGGCGGTAGCGGCGGCGGCGG - Exonic
1056475218 9:86946498-86946520 GGCCGGGAAAGCGGCGGCGGCGG + Exonic
1058686908 9:107488155-107488177 GACCTGGAGAGCGGCGGAGCCGG - Exonic
1060814071 9:126625708-126625730 GACGAGGGTGGCGGCGGCGGCGG - Intronic
1060979890 9:127785891-127785913 GGCGGGGGCAGCGGCGGCGGCGG + Intronic
1060979944 9:127786064-127786086 GGCCTGGAGTGCGGCGGCGGCGG + Exonic
1203621127 Un_KI270749v1:130450-130472 GAGGCGGACAGCGGCGGCGAGGG - Intergenic
1189293867 X:39905054-39905076 GACGTGAGTGGCGGCGGTGGGGG + Intergenic
1195108657 X:101623921-101623943 GACGGGGGTGGCGGCGGGGGTGG + Intronic
1197776329 X:130120879-130120901 CACGCGGAACGCGGCGGCGGCGG + Intergenic