ID: 942241103

View in Genome Browser
Species Human (GRCh38)
Location 2:173964670-173964692
Sequence CGCCGCCGGGGGGCGGGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 705
Summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 658}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942241103_942241117 -10 Left 942241103 2:173964670-173964692 CCCCCACCCGCCCCCCGGCGGCG 0: 1
1: 0
2: 4
3: 42
4: 658
Right 942241117 2:173964683-173964705 CCCGGCGGCGGCGGCGGCGGCGG 0: 25
1: 252
2: 1693
3: 2521
4: 4783

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942241103 Original CRISPR CGCCGCCGGGGGGCGGGTGG GGG (reversed) Intronic
900087377 1:904946-904968 CGCCGCGGGGAGGCGGGTGAGGG + Intergenic
900095976 1:940300-940322 CTCCGCGGCGGGGCGGGGGGGGG - Intronic
900180123 1:1307645-1307667 GGCCGCCGGGGAGGGGCTGGAGG - Intronic
900203152 1:1420228-1420250 GGCCGCGGGCGGGCGGCTGGCGG - Exonic
900334342 1:2154119-2154141 GGCCACTGGGGGACGGGTGGTGG + Intronic
900349740 1:2228680-2228702 CGCCGCCGGGGCGCGCGGGGCGG + Exonic
900386282 1:2412470-2412492 CACCTCCGGGGGGCTGGCGGCGG + Exonic
900417281 1:2540926-2540948 CGGCGGCGGGGGGCGCGGGGGGG - Intergenic
900786947 1:4655290-4655312 CGCGGCCGGCGGGCGGCGGGAGG + Exonic
900786948 1:4655293-4655315 GGCCGGCGGGCGGCGGGAGGCGG + Exonic
900947087 1:5837143-5837165 CGCTGCCGGTGGGCAGGAGGAGG - Intergenic
901019767 1:6249721-6249743 GGCTGCCGGGGGGCGAGTCGCGG + Exonic
901086532 1:6614702-6614724 CGCCGGGGGGCGGTGGGTGGGGG - Intronic
901086621 1:6614890-6614912 CGGCGACCGCGGGCGGGTGGGGG + Intronic
901086693 1:6615075-6615097 TGCCGCGGGAGGGCGGGTGGGGG + Intronic
901109893 1:6785790-6785812 CGCCCCCGGGGGTGGGGTGTGGG - Intronic
901261433 1:7874655-7874677 CGCTGCTGGGGGGATGGTGGGGG - Intergenic
901361289 1:8703147-8703169 CGGCGCAGGCGGGCAGGTGGGGG + Intronic
901526052 1:9824001-9824023 CCCGGCCGGGGGCGGGGTGGCGG + Exonic
901641355 1:10694635-10694657 CGGCACCGGGCGGCGGGCGGCGG - Intronic
901659856 1:10792325-10792347 CGGGGCCGGGGGGGGGGGGGCGG - Intronic
901696615 1:11012615-11012637 GGACGCCGGTGGGCGGGGGGAGG + Exonic
902214121 1:14924039-14924061 CGCCGCGGCGGGGCGGGGGCGGG + Intronic
902348213 1:15834948-15834970 CGCGGCCGAGGGGCGGGGTGTGG - Intergenic
902350118 1:15847982-15848004 CAGCGCCGGGAGGCGGGTGCCGG - Exonic
902896986 1:19485697-19485719 CGCCGACGGGGTGCGGGGGCGGG + Intergenic
903263567 1:22143512-22143534 CGCCGGCGGGGGGCGGTGGGGGG - Intronic
903555133 1:24187422-24187444 CGCCGCGGGGGGAGGGGGGGGGG + Intronic
904039387 1:27575469-27575491 CGCCTCCGCGGCGAGGGTGGTGG - Intronic
904724981 1:32539953-32539975 CGCCGCGGGGGCGCGCGGGGAGG + Intronic
904775132 1:32901551-32901573 CGCCGCCGGTGGGCTGAGGGAGG - Intergenic
904941116 1:34165309-34165331 TCGCGCCGGGGGGCGGGAGGGGG + Intronic
905789731 1:40783743-40783765 GGCGGCCGCGGGGCGGGCGGGGG + Intergenic
906481625 1:46203295-46203317 CGCGGCGCGGGGGCGGGAGGAGG - Intronic
906534305 1:46543310-46543332 CCCAGCGGGGGGGCGGGGGGAGG + Intergenic
907038370 1:51236458-51236480 CCCCGCGGGGGGGCGGGGTGGGG + Exonic
909330093 1:74399569-74399591 TGGGGCCGGGGGGCGGGCGGTGG + Intronic
910787995 1:91021654-91021676 CGCCGCCGCGGGGCGGGACTCGG - Intronic
912927938 1:113929798-113929820 CGGCTCCGGGGGGCGGGGGCCGG + Exonic
913047947 1:115089537-115089559 GGCCTCCGGGGGGCGGGGCGGGG + Intergenic
915213294 1:154325487-154325509 GGGGGCCGGGGGGCGGGAGGGGG - Intergenic
915213299 1:154325494-154325516 CGGCGGCGGGGGCCGGGGGGCGG - Intergenic
915247663 1:154567979-154568001 CGCCGCCGGGGGGAGGGCCGCGG - Exonic
915287806 1:154863992-154864014 CACCACCCTGGGGCGGGTGGCGG + Intronic
915463340 1:156082217-156082239 AGCCCCCGGGGTGGGGGTGGGGG + Intergenic
916548389 1:165827866-165827888 CGCCGCCGTTGGGCTGCTGGTGG - Exonic
917468700 1:175307568-175307590 GGCCGCCGGGGTGAGGCTGGGGG + Intergenic
917869620 1:179229720-179229742 GGCGGGCGGGGGGCGGGGGGCGG - Intergenic
920172394 1:204080207-204080229 CACCGCTGGGGGGAGAGTGGAGG - Intronic
920255625 1:204652262-204652284 GGCGGCGGGGGGGCGGGGGGGGG - Intronic
920660544 1:207910947-207910969 CTTCGCCGCGGGGAGGGTGGAGG - Intronic
921029703 1:211326766-211326788 CGGGGCCGGGGCGCGGGCGGAGG - Intronic
921089662 1:211830698-211830720 CGCCGCCGGGGAACGGGCGCGGG - Exonic
922243967 1:223776992-223777014 GGCGGCGGGGGGGCGGGGGGTGG - Intergenic
922775439 1:228212365-228212387 CGCCGCCGCGGCGCTAGTGGTGG + Exonic
922917568 1:229271128-229271150 CGCGGCCGGACGGAGGGTGGAGG + Exonic
923505235 1:234600034-234600056 CGCGGGCGGGGGGCGCGAGGAGG + Intergenic
924362294 1:243254783-243254805 CTCCGGGGGGCGGCGGGTGGGGG + Intronic
924381972 1:243473916-243473938 TGCCGGCGGGGGGGGGGGGGGGG + Intronic
924415089 1:243850100-243850122 AGCCGGGGGGGGGCGGGGGGAGG + Intronic
924778333 1:247126603-247126625 CGCCGCCGGGGGTCTGGAGAAGG + Intronic
924783325 1:247171817-247171839 CGCCGCCGGGGGTCTGGAGAAGG - Intronic
1062890554 10:1056721-1056743 CGCCGCCGGGTGTGGGGCGGAGG + Intronic
1064231800 10:13535848-13535870 GGGCGGCGGGGGGAGGGTGGGGG - Intergenic
1064384342 10:14877987-14878009 CTCGGCCTGGTGGCGGGTGGGGG - Intergenic
1064443103 10:15371053-15371075 CTCCGCCGCGGGGCCGGCGGCGG + Exonic
1064552951 10:16521068-16521090 CGCCGCCGGGGCGCTGGGGGTGG - Exonic
1065101540 10:22336320-22336342 CGCCTGCGGGGCGGGGGTGGCGG - Intergenic
1065239865 10:23694686-23694708 CTCCGCGGGGTGGGGGGTGGTGG + Intergenic
1065343020 10:24723779-24723801 CGCCGCAGGAGGGCGTGGGGCGG + Intergenic
1065925939 10:30433961-30433983 GGCGGCGGGGTGGCGGGTGGGGG + Exonic
1066382202 10:34911325-34911347 CGGGGGGGGGGGGCGGGTGGGGG - Intergenic
1066464788 10:35641944-35641966 AGCCCCCGGGGGCCGAGTGGTGG - Exonic
1067711830 10:48656259-48656281 CGCCTCTGGGGGGGGGGGGGCGG + Intronic
1068955280 10:62815332-62815354 CGCGGGCGGCGGGCAGGTGGGGG + Intronic
1069698289 10:70404070-70404092 CGTCGCCGCGGGGCGGGGCGAGG - Intergenic
1070610155 10:77927063-77927085 GGCCACGGGGGAGCGGGTGGCGG - Intergenic
1070800844 10:79243572-79243594 CGCCGCCGGGGCGCGGAGCGGGG + Intronic
1072059744 10:91798479-91798501 CGCCGCCGCGGGGCAGCCGGGGG + Exonic
1073249794 10:102114582-102114604 GGCCGCCGCGGGGCGGGCCGAGG - Intronic
1073578247 10:104642177-104642199 GGCCGCCGGGAGGGGAGTGGAGG + Intronic
1073732975 10:106312562-106312584 TGCGGCGGGGGGGGGGGTGGGGG + Intergenic
1073875284 10:107914999-107915021 GGCCGCGGCGGGGCGGGTGGAGG + Intergenic
1074971623 10:118543966-118543988 CTCACCCGGGGGGCGGGAGGAGG + Intergenic
1075048622 10:119165671-119165693 CGCCGCCAGGCCGCGCGTGGAGG + Intergenic
1076657936 10:132036825-132036847 GGCGGCCGTGGGGCGGGCGGGGG + Intergenic
1076683172 10:132185750-132185772 CGCTGCCGGGCGGCAGGAGGCGG + Intergenic
1076749886 10:132537415-132537437 CGCAGCCGCGGCGCGGGGGGCGG + Intergenic
1076907923 10:133372718-133372740 CGGTGCGGGGTGGCGGGTGGTGG + Intronic
1077058428 11:607228-607250 CGCCCCCGCGGTGCGGGCGGGGG - Exonic
1077327403 11:1969688-1969710 CGCCGCCCTGGGTTGGGTGGCGG - Intronic
1077495852 11:2886153-2886175 AGCCGGCGGGGGGCGGGAGCCGG - Intergenic
1077976260 11:7251849-7251871 GGCCGCCGGGGGGCGGGGCCAGG - Intronic
1078102414 11:8337632-8337654 CGACGGCGGGGGGCGGGGGGGGG + Intergenic
1078256658 11:9664300-9664322 CGCCGGGGAGGGTCGGGTGGGGG - Intronic
1078317973 11:10307644-10307666 GGCCGGCGGGGGGTGGGTAGGGG + Intergenic
1078800893 11:14643627-14643649 GGCGGCCGCGGCGCGGGTGGCGG + Intronic
1081700062 11:45147043-45147065 CGCCGGCGCGGGGTGGGGGGCGG + Intronic
1081774078 11:45665771-45665793 TGCCCCCGGCGGGTGGGTGGGGG - Intergenic
1081891364 11:46545158-46545180 AGCCGGGGGGGGGGGGGTGGTGG + Intronic
1083171088 11:60924487-60924509 TGCAGCCGCGGGGCGGGCGGCGG + Exonic
1083265760 11:61546203-61546225 CGCCGCGGCGGGGCTGGCGGTGG - Exonic
1083648529 11:64186613-64186635 GGCCGCAGGGGGCGGGGTGGAGG + Intronic
1083726305 11:64630352-64630374 CGCGGTGGCGGGGCGGGTGGCGG - Intronic
1083849198 11:65355350-65355372 CGCCGCTGGGGGGTGGGAGGTGG - Intronic
1083936514 11:65872561-65872583 CGCCGCAGGGGCGCGGGGCGGGG - Intronic
1083936583 11:65872803-65872825 CGCGGCAGGCGGGCGGGCGGGGG - Exonic
1083936637 11:65872932-65872954 CGCCGCGGGGGACCGGGTAGGGG - Intronic
1084146766 11:67269178-67269200 GGGCGGCGGGGGGCGGGGGGCGG - Intronic
1084180562 11:67443583-67443605 CGGCGCCGGGGGGCCGGGAGCGG + Intronic
1084189311 11:67491838-67491860 CAGCGCCGGGGGGAGGGAGGAGG - Exonic
1084424353 11:69076608-69076630 CACCGCAGGAGGGCAGGTGGAGG - Intronic
1084892072 11:72241564-72241586 CGACGACGGGGGTGGGGTGGGGG - Intronic
1084972999 11:72781606-72781628 GGCGGGCGCGGGGCGGGTGGCGG + Intronic
1084978112 11:72814343-72814365 TGACGCCAGGGGGCGGGCGGCGG - Exonic
1085284572 11:75351548-75351570 GCCCGGCGGGGGGCGCGTGGGGG - Intronic
1085474819 11:76783256-76783278 CCCTGCCGGGCGCCGGGTGGCGG - Intronic
1085517035 11:77117630-77117652 CGCCTCCAGGGAGCTGGTGGGGG - Intronic
1085666214 11:78417609-78417631 GGCCGCCCAGGGGCGGGCGGGGG - Intronic
1088893468 11:114061254-114061276 GGGCGCCGAGCGGCGGGTGGGGG + Intronic
1089564656 11:119364286-119364308 CGGCGCCGGGGGCGGGGTAGAGG - Intronic
1089622454 11:119729503-119729525 CGCCGAGGCGCGGCGGGTGGGGG + Intergenic
1089694964 11:120211224-120211246 CGCCGCGTGGGGGCGGGGAGAGG - Exonic
1089738409 11:120564967-120564989 CGCCGGCTGCGGGGGGGTGGGGG + Intronic
1090788685 11:130070664-130070686 TGCCGCCTGGGGCCGGGTCGCGG + Intronic
1090832487 11:130428797-130428819 CACTTCAGGGGGGCGGGTGGCGG - Exonic
1090978391 11:131695037-131695059 CGCCGCCGCCGGGAGGGTGCAGG + Intronic
1091238563 11:134037387-134037409 CGCCGCGGAGGGGAGGGCGGTGG + Intergenic
1202810385 11_KI270721v1_random:24868-24890 CGCCGCCCTGGGTTGGGTGGCGG - Intergenic
1091567896 12:1661869-1661891 AGGCGGCGGGGGGCGGGGGGCGG + Intergenic
1091616122 12:2052686-2052708 GGCCGCCGGCGGGCGAGGGGCGG - Intronic
1091740730 12:2959183-2959205 CGCAGCCGAGGCCCGGGTGGAGG + Intergenic
1092170577 12:6371518-6371540 CGTGGCGGGGGGGCGGGGGGTGG + Intronic
1092187814 12:6493875-6493897 CGCCGCCCGGGGGCGGGCCAAGG - Exonic
1092462340 12:8697842-8697864 CGCCGCGGCGCGGCGGGCGGGGG - Intronic
1092743164 12:11649548-11649570 GGCCGCGGGGGCGCGGGCGGAGG - Intergenic
1092743210 12:11649784-11649806 AGCCGCGGGAGGGCGGGGGGCGG + Intergenic
1094375422 12:29783804-29783826 CGCCGCCGGGGCCCCGGTAGGGG - Exonic
1094586547 12:31782337-31782359 CGCCACCGGCAGGCGGGAGGAGG + Intergenic
1094753357 12:33439123-33439145 CGGCGCCGGGAGGCGGGAAGCGG + Intronic
1095206159 12:39442889-39442911 CGGCGGCGGGCGGCGGGCGGCGG - Intronic
1095465513 12:42484104-42484126 CGCCGCCCGCGGGCGGGAGCGGG - Intronic
1095962615 12:47844901-47844923 GGCTGCCCGGGGGCGGGTGGCGG + Exonic
1096134587 12:49188795-49188817 CGCCGCCGCAGTGCGGGTGCAGG - Intronic
1096241325 12:49961794-49961816 CGGCGCGGGGGGGCAGGGGGCGG - Intergenic
1097267542 12:57755026-57755048 GGGCGCCGGGGAGCGGGTGAAGG - Intronic
1098254799 12:68606091-68606113 CGGCGGCGGGGGGGGGGGGGAGG + Intergenic
1100444651 12:94650003-94650025 GGCCGCGGGTGGCCGGGTGGCGG + Intronic
1101340924 12:103841292-103841314 CGCCGCTGCGGGGCGGGGAGTGG + Intergenic
1101592779 12:106138854-106138876 CGCGGCCGGGGGGCGGTGCGCGG - Exonic
1101727845 12:107402927-107402949 CACAGCCTGGGGGTGGGTGGGGG - Intronic
1102258811 12:111431010-111431032 TGCCGGCCGGGGGTGGGTGGCGG + Intronic
1102973555 12:117190159-117190181 CGGCCCCGGGGGGCGCGGGGCGG + Intronic
1103562417 12:121799711-121799733 CGCAGCTGGGGGGGGGGGGGTGG + Intronic
1103720096 12:122969175-122969197 GGCAGCCGGGGGGGGGGGGGGGG - Intronic
1103779400 12:123389114-123389136 CGCCGCGGCGGCGCTGGTGGCGG + Intronic
1103927670 12:124432853-124432875 TGGCGGCGGGGGGCGGGGGGTGG + Intronic
1104140131 12:125979667-125979689 GGCCGGGGGGGGGGGGGTGGGGG + Intergenic
1104842230 12:131830619-131830641 CGCCTCCGGCGAGCGGGCGGAGG - Intronic
1104910113 12:132236262-132236284 GGCTGGCGGGGAGCGGGTGGGGG + Intronic
1105217474 13:18297568-18297590 CGCCGCGGCGGCGCTGGTGGCGG + Intergenic
1105389233 13:19959248-19959270 CTCCGGCGGGGGGCGGGGGAGGG + Intronic
1105502883 13:20988337-20988359 CGCAGCCGGGGCGGGGGCGGGGG + Exonic
1105699579 13:22926359-22926381 GGCCGGGGCGGGGCGGGTGGTGG + Intergenic
1106182437 13:27380935-27380957 CCCAGTCGGGGGGGGGGTGGGGG + Intergenic
1106243392 13:27927538-27927560 GGCTGCCGGGGGACTGGTGGGGG - Intergenic
1106332683 13:28754090-28754112 CATCGCCTGGGGGCTGGTGGAGG - Intergenic
1110887255 13:80655162-80655184 CCCCGCCGGGCTGCGGGAGGAGG - Intergenic
1113254850 13:108495734-108495756 AGCCGCCGCCGAGCGGGTGGCGG + Intergenic
1113517416 13:110914515-110914537 GGCAGCCGGGGGGCGCGGGGCGG - Intronic
1113914780 13:113863786-113863808 CGTCCCCGGGCGGCGGGAGGAGG - Intronic
1114270645 14:21098252-21098274 CGGGGGCGGGGGCCGGGTGGCGG + Intronic
1114755264 14:25252626-25252648 AGCTGGCGGGTGGCGGGTGGGGG + Intergenic
1116452878 14:45084129-45084151 GGCGGCCGTGGCGCGGGTGGCGG + Exonic
1117176760 14:53153332-53153354 CGCGGCCGGGGGGCGGGGCGGGG - Intergenic
1118292462 14:64539600-64539622 CGCCGCGTGAGGGCGGCTGGCGG - Intronic
1118350729 14:64971489-64971511 AGCCGGCGGGGGGCGAGGGGGGG - Intronic
1118858436 14:69642643-69642665 CCCAGCAGGGGGGCGGGGGGCGG - Intronic
1118955637 14:70477790-70477812 CCCCGCCGGGAGGGAGGTGGGGG + Intergenic
1119003902 14:70907520-70907542 CGCTGGCGGGCCGCGGGTGGCGG + Exonic
1119330079 14:73787060-73787082 CGGCGCCCGGTGGCGGGAGGGGG + Intronic
1120914792 14:89701673-89701695 CGGCGCCGGGAAGCGGGGGGGGG - Intergenic
1121535733 14:94689659-94689681 CGCCGCCTCGTGGCGGGTGCGGG - Intergenic
1122130860 14:99604043-99604065 CGCGGGCGGGGGGCGGCCGGGGG + Intergenic
1122270669 14:100567416-100567438 CGCCTCTGGGGGGCGGGGGTGGG - Intronic
1122543372 14:102509716-102509738 CGCCGGCGGCGGGCGGCGGGCGG + Exonic
1122543374 14:102509719-102509741 CGGCGGCGGGCGGCGGGCGGCGG + Exonic
1122905783 14:104800840-104800862 CGGAGGCGTGGGGCGGGTGGCGG + Intronic
1123204032 14:106694770-106694792 AGCCACCGGGGGGGGGGGGGGGG - Intergenic
1123396572 15:19943770-19943792 CGCGGCCGCGGGGGGGTTGGGGG - Intergenic
1123684397 15:22786853-22786875 GGCAGGCGGCGGGCGGGTGGGGG + Intronic
1123689298 15:22823623-22823645 CGGTGGCGGGTGGCGGGTGGGGG + Intronic
1123709968 15:22980157-22980179 CGCCGCCGGGGTTGGGGGGGAGG + Intronic
1124816062 15:32993895-32993917 AGCAGCCGGGGGCGGGGTGGGGG + Intronic
1124971480 15:34494370-34494392 CGGCCCCGGGAGGTGGGTGGCGG - Intergenic
1125577174 15:40763943-40763965 CGCCGCCGGGAGGGCGGGGGCGG + Intergenic
1126661689 15:51039027-51039049 CACCACAGCGGGGCGGGTGGGGG - Intergenic
1127546788 15:60000036-60000058 CGGTGCTGGGGGGCTGGTGGGGG + Intergenic
1128067863 15:64775615-64775637 CGGCGGCGGGGGGCGGGCGCCGG + Intergenic
1129082575 15:73053003-73053025 GGCTGCCGGGGGGCAGGTCGGGG + Intronic
1129880228 15:79001488-79001510 GGGTGGCGGGGGGCGGGTGGTGG + Intronic
1129904813 15:79179047-79179069 CACCGGCGGGGAGTGGGTGGTGG + Intergenic
1129983643 15:79897077-79897099 CGCGGCCTAGGGGCGGGTCGGGG + Intronic
1130908695 15:88256834-88256856 CCCGGGCGGGGGGCGGGGGGAGG - Intergenic
1131763201 15:95646495-95646517 GGCGGCGGGGGGGCGGGTGGGGG + Intergenic
1132055649 15:98648873-98648895 GGCCGGCGCGGGGCGGGCGGCGG + Intergenic
1132150756 15:99456499-99456521 GGTTGCCGGGGGGCGGGTAGGGG - Intergenic
1132522397 16:397646-397668 CCCGGCCGGGGTGGGGGTGGGGG + Intronic
1132567499 16:630174-630196 CGCCGACGGGGGGCTGGGGCAGG + Intronic
1132575419 16:661654-661676 CGGCTCCGGGAGGCGGGTGGAGG - Exonic
1132657345 16:1046804-1046826 AGCCGGCGGGCAGCGGGTGGCGG + Intergenic
1132683809 16:1154048-1154070 GGCCGGCGGGGGGCGGGGGGCGG + Intronic
1132889308 16:2196255-2196277 CCCCGCCCGGCGCCGGGTGGGGG + Intronic
1132934888 16:2475200-2475222 CGCGGCGGGGTGGCGGGTGGCGG + Intronic
1132994737 16:2817189-2817211 CGCCCCCTGGGGGCGGGGCGGGG - Intronic
1133336954 16:5012448-5012470 CGCCCTCAGGGGGCAGGTGGTGG + Intronic
1136272195 16:29154931-29154953 GGCCGCAGGGGGGCAGCTGGAGG + Intergenic
1138106332 16:54288858-54288880 CGCCGGCGGGTGGGGGGGGGGGG + Intergenic
1138651471 16:58463726-58463748 CGCCGCCGACGCGCGGGTGCAGG - Intronic
1139576791 16:67847084-67847106 GGCCGCCGGGGGGGGGGGAGGGG - Intronic
1139750445 16:69106455-69106477 CGGCGCGGGGAGGCGGGTTGGGG + Intronic
1139954401 16:70686272-70686294 CGCCACCGAGGGTCGGGGGGCGG + Intergenic
1140442507 16:74998889-74998911 GGCCGGCCGGGGGCGGGCGGTGG + Intronic
1140469477 16:75206188-75206210 CGCAGCCTGGGGGCGGGAGTGGG + Exonic
1141959159 16:87392723-87392745 AGCCGGCGGAGGGCGGGCGGGGG + Intronic
1141972582 16:87493193-87493215 GGCCGCCGAGGGACGGGAGGCGG - Intergenic
1141989570 16:87602431-87602453 CGGGGGCGGGGGGCGGGGGGCGG + Intronic
1142075772 16:88116835-88116857 GGCCGCAGGGGGGCAGCTGGAGG + Intronic
1142098539 16:88259247-88259269 CGCTTCGGGGGGGCGGGGGGTGG - Intergenic
1142240182 16:88941386-88941408 CGGCGGCGGGGGGCAGGAGGCGG - Intronic
1142350047 16:89575695-89575717 CGCGGCCGGGGGGCGGGGCCGGG - Intergenic
1142671235 17:1488272-1488294 CGCCGCCGGGCGGTGGCTGCGGG - Intronic
1142671941 17:1491552-1491574 CGGCCGCGGGGGGCGGGTGTGGG - Intronic
1142810622 17:2393973-2393995 CGCGGCCGGGGGAGGGGCGGCGG + Intronic
1142840656 17:2626555-2626577 CGCCTCGGGGGGGGGGGGGGGGG - Intronic
1142876291 17:2853642-2853664 CGAGGCCGGGGCGCGGGAGGCGG + Intronic
1143390482 17:6556610-6556632 CGGCGCGGGGGGTGGGGTGGGGG - Intergenic
1143539698 17:7561780-7561802 CGCCGCCCGGCCGCGCGTGGCGG - Intergenic
1144828828 17:18120894-18120916 CGGCCCAGGGCGGCGGGTGGCGG - Exonic
1144851682 17:18247125-18247147 GGGCGCGGGGGGGGGGGTGGGGG - Intronic
1144956989 17:19023640-19023662 AGCCGCGGGGTGGGGGGTGGGGG - Intronic
1145960903 17:28886045-28886067 TGACGCCTGGGGGCGGGGGGGGG + Intronic
1146034088 17:29390826-29390848 CGGCGGCGGGGGGTGGGGGGGGG - Exonic
1146229483 17:31095279-31095301 CGCGGCCGGGGGGCGGCGGAGGG - Exonic
1147000580 17:37359275-37359297 GGCCGCCGGGGGGCGAGGCGCGG + Intronic
1147200723 17:38799637-38799659 CACCGCCCGGGGGCGGGGTGCGG - Exonic
1147412628 17:40264708-40264730 CGCCGCCCTGGGGGTGGTGGGGG - Exonic
1147811245 17:43171272-43171294 CGCCCCCGGGGGGCGCCTGCCGG - Intronic
1147971301 17:44220073-44220095 CGCCGCCGGGGAAGGGGGGGGGG + Intronic
1148262162 17:46193271-46193293 CGCCGCGGCGGCGCGGGGGGCGG - Intronic
1148394279 17:47295762-47295784 AAAGGCCGGGGGGCGGGTGGGGG + Intronic
1148698634 17:49575665-49575687 CGCCGCCGGTGGGAGGGACGAGG + Intergenic
1148931511 17:51130913-51130935 GGCTGATGGGGGGCGGGTGGCGG - Intergenic
1149296283 17:55265044-55265066 CGCCGGCGCGGGGAGGGGGGTGG + Exonic
1149626360 17:58083359-58083381 CGCGGCGGGGGGGCGGGGGCGGG + Intergenic
1150228726 17:63538357-63538379 CGCGGCCGGGGTGGGGCTGGGGG - Intronic
1150388634 17:64778718-64778740 CTCCGCTGGGGGGCCGTTGGGGG + Intergenic
1151491035 17:74432448-74432470 CCCAGGCGGGGGGCGGGCGGGGG - Intronic
1151565095 17:74893305-74893327 CCCGGCCGGGCTGCGGGTGGGGG - Intronic
1151743657 17:76000604-76000626 CGCCGGCGGGGGCCAGGAGGGGG + Intronic
1151933506 17:77247623-77247645 CACCGCCGGGGGTCGGGGTGGGG + Intergenic
1152037057 17:77880070-77880092 CGCTGCCGGGCGGCAGGAGGCGG + Intergenic
1152237453 17:79145907-79145929 GGCCGCCGGGGGCAGGGGGGTGG + Intronic
1152625627 17:81386835-81386857 AGGCGCCGGGGGGCGGAGGGAGG + Intergenic
1152625657 17:81386938-81386960 CGCCGGCCGGGGGCGGGGCGCGG + Intergenic
1152641792 17:81452371-81452393 GGCCGCAGGGTGGCGGGTGAGGG + Intronic
1152643589 17:81458994-81459016 AGCCGCCTGGGGAGGGGTGGTGG + Intronic
1152651795 17:81498138-81498160 GGCTGCCGGGGGCTGGGTGGAGG + Intergenic
1152728822 17:81960250-81960272 CGACACCGGGGGGCGGGGAGAGG - Intronic
1152744183 17:82031591-82031613 GGCCGGCGGGGGGCGGGGGGCGG - Intergenic
1153320712 18:3771462-3771484 CTCGGCCCGGGGGCGGGTGGCGG + Intronic
1153382602 18:4455378-4455400 CGGAGCCGGCGGGCGGGCGGCGG + Intergenic
1153636479 18:7117605-7117627 CCCCGCAGGCGGGCGGGCGGGGG - Intronic
1153794469 18:8609671-8609693 CGCAGCCGGGGGGCGGGCGGCGG + Exonic
1153805360 18:8705491-8705513 CGGGGCCGGGGTGCGGGGGGCGG + Intergenic
1154072399 18:11164572-11164594 CGTGGTCTGGGGGCGGGTGGAGG + Intergenic
1155007500 18:21741513-21741535 TGCCGCCGGGGGGCCCGTGAGGG - Exonic
1156098641 18:33566345-33566367 CCCAGCTGGGAGGCGGGTGGGGG + Intergenic
1159999760 18:75005703-75005725 TGGCGGCGGGGGGTGGGTGGGGG - Intronic
1160163322 18:76491540-76491562 CGGGGGCGGGGGGCGGGGGGCGG + Intronic
1160500948 18:79400838-79400860 GGAGGTCGGGGGGCGGGTGGGGG - Intronic
1160514755 18:79472146-79472168 AGCCGTGGGGGGGCGGGGGGCGG + Intronic
1160668433 19:344508-344530 CGGCGGCGCGGGGCGGGCGGGGG - Intronic
1160680104 19:408493-408515 TGCCGGCGGGGTGGGGGTGGAGG + Intronic
1160725434 19:616131-616153 CGCGCCCGGGGGGCTGGCGGGGG - Exonic
1160762285 19:791724-791746 CTCCCCCGGGGGGAGGGGGGAGG + Intergenic
1160769130 19:822383-822405 CTCCGCGGAGGGGCGGGCGGAGG - Intergenic
1160844903 19:1161901-1161923 AGCCGCGGGGGGGGGGGGGGGGG + Intronic
1160858702 19:1228669-1228691 CGCCGCCCTGGGCCGGGAGGCGG - Exonic
1160904582 19:1446241-1446263 GGCCGCCGAGGGGCGGGGCGCGG + Intergenic
1160930162 19:1566671-1566693 CGGGGCGGGCGGGCGGGTGGTGG - Intronic
1160982743 19:1823732-1823754 CGCCGTCGGGGGCCGGGCCGGGG + Exonic
1160989536 19:1854922-1854944 GGCCACCGGGGGGCGGGTAAGGG - Intronic
1161072692 19:2270507-2270529 GGCCGCCGGGGAGCTGGGGGTGG + Intronic
1161153221 19:2720415-2720437 CGCCTGGGGGGTGCGGGTGGAGG + Intronic
1161266406 19:3366674-3366696 CGCCGGCGGGGGGCCGGGCGAGG - Intronic
1161378794 19:3953631-3953653 AGCTGCAGGGGGGCGGGGGGGGG + Intergenic
1162237523 19:9320832-9320854 AGCCGGCGGGGGGGGGGTGGGGG + Intergenic
1162362957 19:10230704-10230726 CCCCGCCGGGGGACCGGAGGAGG + Intronic
1162561285 19:11419325-11419347 GGCCGGCGGGTGGCGGGTGGCGG + Exonic
1162755733 19:12858457-12858479 CTCTGGCGGGGGGAGGGTGGCGG + Intronic
1162962650 19:14136957-14136979 CGCCACCGCTCGGCGGGTGGCGG - Intergenic
1163121932 19:15223526-15223548 GGCCGCCGGCGGGAGGGAGGCGG - Intergenic
1163135495 19:15308141-15308163 CGGGGCCGGGGGGGGGGGGGGGG + Intronic
1163138657 19:15331987-15332009 GGCCGGCGGGGCGCGGGTGGGGG - Intronic
1163441236 19:17323653-17323675 AGGGGCTGGGGGGCGGGTGGGGG + Exonic
1163490827 19:17616375-17616397 CGCGGGCGGCGGGCGGGAGGCGG + Intronic
1163505636 19:17704404-17704426 TGGCGCCGGGTGGGGGGTGGGGG + Intergenic
1163548103 19:17951069-17951091 CCCCGCCGGGGGGCTGGGGAGGG + Intergenic
1163701878 19:18790215-18790237 CGCCCCGGGGCGGGGGGTGGGGG - Intronic
1163701882 19:18790218-18790240 GGCCGCCCCGGGGCGGGGGGTGG - Intronic
1164835123 19:31350907-31350929 CGCTGCCGGGCGGCGGCTGCTGG + Intergenic
1164995846 19:32720138-32720160 CGCGGCTGGGGTGGGGGTGGGGG - Intronic
1165040235 19:33063803-33063825 GGGCGGCGGGCGGCGGGTGGCGG - Intronic
1165243145 19:34482562-34482584 CGCGGCCGAGCGGCGGCTGGAGG + Exonic
1165349607 19:35268822-35268844 CGGAGCCGGCGGGCGGGCGGAGG + Intergenic
1165421406 19:35723806-35723828 CCACGCCGGGGGGCGGGAGCTGG + Exonic
1165448240 19:35868521-35868543 CGCAGCCCGGGGGCGGCGGGAGG + Exonic
1165725574 19:38110393-38110415 CGCTGCTGGGGGCCGGGTGTGGG - Intronic
1165738793 19:38193716-38193738 CGGGGCCGACGGGCGGGTGGGGG - Exonic
1165850782 19:38849418-38849440 CGCCGCGGGCTGGCGTGTGGGGG - Intronic
1166364993 19:42273830-42273852 CGCTCTCGGGGGGCAGGTGGCGG - Intronic
1166367399 19:42284474-42284496 CGCCGCCCGGGGGGCGGGGGAGG - Intronic
1166531937 19:43548059-43548081 CCCCGTCGGGGGGGAGGTGGGGG + Intronic
1166694415 19:44844669-44844691 CCGCGCCGGGGGGCGGGATGAGG - Intergenic
1166855211 19:45779865-45779887 CTCCGCTGGGGGGGTGGTGGGGG + Exonic
1167056219 19:47112845-47112867 CGCCCCCCGGGGGTGCGTGGGGG - Intronic
1167072762 19:47230514-47230536 CGGCGACGGGGGGCGGCTCGCGG - Intronic
1167381786 19:49142572-49142594 GGGGGGCGGGGGGCGGGTGGGGG - Intronic
1202683546 1_KI270712v1_random:30239-30261 CGCGGCACCGGGGCGGGTGGGGG - Intergenic
925004957 2:435406-435428 ACCCACCGGGGGGCTGGTGGTGG - Intergenic
925927642 2:8681794-8681816 GGCTGGCGGGGGGCGGGGGGCGG - Intronic
926012960 2:9423192-9423214 CGCTCCCGGGGCGCGGGTGGAGG - Exonic
926094624 2:10073210-10073232 CACAGCCGGGGGGGGGGGGGGGG - Intronic
926154935 2:10448423-10448445 CACCGCCGGGGGAGGGGCGGGGG + Exonic
926801775 2:16665735-16665757 CGCGGCAGGGGCGCGGGCGGGGG - Intronic
927872975 2:26635303-26635325 CACCTCCTGGGGGCTGGTGGGGG - Intronic
927881433 2:26692637-26692659 TGCGGGCGGGGGGCGGGGGGCGG + Intergenic
927881504 2:26692840-26692862 GGGCGCCGGGGGGCCGGCGGCGG + Exonic
928511740 2:32009996-32010018 CGCCGCCCGGGTGGGGGAGGCGG + Intronic
929044339 2:37775571-37775593 CTCAGCCTGGCGGCGGGTGGGGG - Intergenic
929604286 2:43224984-43225006 GGCCGCCCGGGGGCTGATGGTGG + Exonic
930136361 2:47906544-47906566 GGCCGCGGGGCGGCGGGGGGAGG + Intergenic
930700741 2:54456461-54456483 GGCCGCCGAGGAGCGGGAGGAGG + Exonic
931614642 2:64144017-64144039 GGCCGCCGAGGGGCGCGGGGAGG - Intronic
931694258 2:64859963-64859985 CGCAGCCCCGGGGCGGGAGGGGG + Intergenic
932231346 2:70086886-70086908 CGCCGCCGGGGAGCAGGAGCTGG + Intergenic
932699991 2:73985451-73985473 CGCCGCCGAGGGGCGCGGGGAGG - Intergenic
932823360 2:74920023-74920045 CGTCCCCCGGGAGCGGGTGGCGG + Intergenic
933723679 2:85414024-85414046 CACCTCCAGGGGGCGGGGGGCGG - Intronic
933909895 2:86930326-86930348 CGGAGGCGGGGGGCGGGGGGTGG + Intronic
934022831 2:87973062-87973084 CGGAGGCGGGGGGCGGGGGGTGG - Intergenic
934248228 2:90324839-90324861 CGCGGCACCGGGGCGGGTGGGGG + Intergenic
934248445 2:90325606-90325628 CGCAGCACCGGGGCGGGTGGGGG + Intergenic
934248577 2:90326034-90326056 CGTCGCCCGGGGTCGGGGGGTGG + Intergenic
934261288 2:91478460-91478482 CGGCGGCAGGGGGCGGGGGGTGG - Intergenic
934296832 2:91749083-91749105 CGCCGCCGCGGCGCTGGTGGCGG - Intergenic
934567567 2:95349088-95349110 CTCTGACGGGGGGCGGGGGGGGG - Intronic
934966822 2:98731001-98731023 CGGCGCGCGGGGGCGGGAGGGGG - Intronic
935292564 2:101622530-101622552 CGCCGGCGGGGGGCGGTGGGTGG - Intergenic
935622816 2:105144072-105144094 AGCTGCCGGGGGCCGGGAGGAGG - Intergenic
935746506 2:106194078-106194100 CGCCGCGGTGGGCCGGGCGGCGG - Intronic
937070654 2:119060664-119060686 CGGGGCCGGTGGGTGGGTGGGGG + Intergenic
937236195 2:120433116-120433138 CGCAGTCAGGGGGTGGGTGGTGG + Intergenic
937283397 2:120735735-120735757 CGCCGCCGGGGCGGGGGGAGGGG - Intronic
937917459 2:127106156-127106178 GGCGGCCGGGGAGCGGGTGGCGG - Intronic
938099194 2:128486617-128486639 CGTGGCCGGGGGCGGGGTGGGGG + Intergenic
938418422 2:131123778-131123800 CGAGGGCGGGGGGCGGGGGGGGG - Intronic
940226916 2:151410087-151410109 CGCCGCGAGGGGGCGGAGGGTGG - Exonic
940353813 2:152717835-152717857 GGCCGCCAGGGGTAGGGTGGAGG + Exonic
940640756 2:156342373-156342395 AGCCGCCGGGGGCCGGGGGCCGG - Intergenic
941188370 2:162344756-162344778 CCCCGCCTGGGGGCGAGCGGGGG - Intronic
941728573 2:168890447-168890469 CTGCGCCTGGAGGCGGGTGGCGG - Intronic
942147917 2:173044261-173044283 TGGCGCCGGGGGGCGGGAGGGGG + Intronic
942241103 2:173964670-173964692 CGCCGCCGGGGGGCGGGTGGGGG - Intronic
945225613 2:207529492-207529514 CGCCGCCGGGAGACGGGGGACGG - Intergenic
945225944 2:207530638-207530660 CGCCGCCTAGGTGCCGGTGGGGG + Intronic
945699420 2:213151733-213151755 CGGCGGCGGCGGGCGGCTGGCGG + Intronic
945955415 2:216081873-216081895 CGCGGCCGGCGGGCGGGGCGGGG - Exonic
946326002 2:218985076-218985098 CGCCGCCGGGGACTGGGCGGTGG + Exonic
946339190 2:219057404-219057426 CGCCGCCGGGGGGCTGGGCCCGG - Intronic
946340031 2:219060757-219060779 CGGCGGCGGGGGGCGGCGGGCGG + Intergenic
947702658 2:232247611-232247633 TGCCGCGGGGGGGGGGGGGGGGG + Intronic
948140519 2:235669636-235669658 GGCCGAAGGGTGGCGGGTGGCGG - Intronic
948854757 2:240724928-240724950 CGGCGGCGGGGGGGGGGGGGGGG + Intronic
948901417 2:240958568-240958590 GGCTGGCGGGGGGCGGCTGGTGG - Intronic
1168756768 20:324174-324196 CGGCGCGGGGGGCGGGGTGGGGG - Intergenic
1168765832 20:381203-381225 GGAGGCCGGGGGGCGGGAGGGGG + Intronic
1169367264 20:5001510-5001532 CGCCGCGGAGGGGCGGGCCGGGG + Intronic
1170629651 20:18056500-18056522 CGCCGCCCAGGGGCAGGTGCAGG + Intronic
1170998618 20:21391526-21391548 CGCAGCCGGGGGCGGGATGGTGG + Intergenic
1172218942 20:33258769-33258791 TGGCGGCGGGGGGCGGGGGGGGG + Intergenic
1172529303 20:35619107-35619129 CGGGGGCTGGGGGCGGGTGGGGG - Intronic
1172702682 20:36862885-36862907 CGCGGCCGGGGGCCCGGCGGGGG - Exonic
1172951100 20:38724072-38724094 CGCCGCCGCAGGGTGGGAGGGGG - Intergenic
1172951535 20:38726054-38726076 CGCCGCCTGGTGGGGAGTGGGGG - Intronic
1173663589 20:44750627-44750649 CGCCCCCGGGGGGCGCGGGCTGG - Exonic
1174386802 20:50192138-50192160 CGCCGCCGGGGGCGGGGGCGAGG - Exonic
1174467892 20:50731529-50731551 CGCCGCCGGGGCCCGGAGGGAGG + Exonic
1174494602 20:50930882-50930904 CGGCGGCGGCGGGCGGATGGCGG + Exonic
1174494708 20:50931244-50931266 GGCGGCCGGGGGGGGGGGGGCGG + Intergenic
1175190673 20:57210503-57210525 CTCCCCTGGGAGGCGGGTGGTGG - Intronic
1175210473 20:57350906-57350928 CGGGGGCGGGGGGCGGGGGGGGG + Intergenic
1175268987 20:57720439-57720461 AGCCCGCGGGGGGGGGGTGGGGG + Intergenic
1175429258 20:58890963-58890985 CGCCGCCGAGGGGCTGGGGTGGG - Intronic
1176015030 20:62926524-62926546 CGCCCCCGCGCGGCGGGCGGAGG + Intronic
1176062564 20:63178781-63178803 TGGCGTCGCGGGGCGGGTGGGGG + Intergenic
1176194454 20:63830946-63830968 CGCCCCCGCGGGGCGGGGCGTGG + Intronic
1176201545 20:63863039-63863061 CGCCGACGCGGGGCGGGGCGGGG + Exonic
1176244767 20:64092128-64092150 AGCCGCTGGAGGTCGGGTGGGGG + Intronic
1176547026 21:8206540-8206562 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1176548059 21:8209888-8209910 CCCGGCCGGGGGGCGGGCGCCGG + Intergenic
1176554931 21:8250749-8250771 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1176555952 21:8254098-8254120 CCCGGCCGGGGGGCGGGCGCCGG + Intergenic
1176565977 21:8389587-8389609 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1176566990 21:8392923-8392945 CCCGGCCGGGGGGCGGGCGCCGG + Intergenic
1176573852 21:8433774-8433796 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1176574889 21:8437133-8437155 CCCGGCCGGGGGGCGGGCGCCGG + Intergenic
1176611504 21:8988429-8988451 CCCGGCCGGGGGGCGGGCGCCGG + Intergenic
1176952442 21:15064223-15064245 AGCGGCCCGGGGTCGGGTGGGGG + Intronic
1178377060 21:32075540-32075562 TGTGGCCGGGGGGCGGGGGGTGG - Intergenic
1178440421 21:32593871-32593893 CGGCGGCGGGGGGCGGTGGGGGG - Intronic
1178513828 21:33229896-33229918 CGCCGCCGGCGCGGGGGCGGGGG - Intronic
1178535105 21:33404018-33404040 CGGCGCGGGCGCGCGGGTGGGGG - Intronic
1178992383 21:37366699-37366721 CGGGGCTGGGGGGCGGGAGGAGG + Intronic
1179363148 21:40731731-40731753 CTCACCCGGGGGGCGGGGGGGGG - Intronic
1180068229 21:45423492-45423514 GCCCTCCGGGGGGCGGGGGGCGG - Intronic
1181457969 22:23070377-23070399 CGGCGCGGGAGGGCGGGCGGAGG + Exonic
1181586892 22:23857571-23857593 CGCCGCGGGGGGGGGGTTTGGGG - Intronic
1182123506 22:27801077-27801099 GGACTCCGGGGGGCGGGGGGAGG - Exonic
1182355470 22:29720608-29720630 CGGGGGCGGGGGGCGGGGGGCGG + Intronic
1183383342 22:37501460-37501482 CACTGCCGGGGGCCAGGTGGGGG + Intronic
1183403213 22:37616923-37616945 AGCAGCCGGGTGGCGAGTGGAGG - Exonic
1183452786 22:37906018-37906040 CGCCGTCGAGGGGCGGGCGATGG + Intronic
1183517133 22:38273040-38273062 CGCCGCCGGGGAGGGCGGGGCGG + Intergenic
1183586352 22:38755459-38755481 CGCTGCCCGGGGCCGGGTTGGGG + Intronic
1183720193 22:39557905-39557927 AGCCCCCGGGGCGCGGGGGGCGG - Intergenic
1184101644 22:42344139-42344161 GGCGGCCGGTGGGCTGGTGGGGG - Intergenic
1184276822 22:43413316-43413338 CGGCGCCGGGGGGCGGGGGCGGG + Intronic
1184697867 22:46150112-46150134 CGCGGCCGCGGGGCGGGTGGAGG - Intergenic
1185278863 22:49961392-49961414 CGGCGGCGGGGGGCGGGCGCGGG + Intronic
1185286038 22:50000299-50000321 CGTGGATGGGGGGCGGGTGGAGG - Intronic
1203251901 22_KI270733v1_random:122825-122847 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1203252938 22_KI270733v1_random:126188-126210 CCCGGCCGGGGGGCGGGCGCCGG + Intergenic
1203259952 22_KI270733v1_random:167908-167930 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1203260993 22_KI270733v1_random:171269-171291 CCCGGCCGGGGGGCGGGCGCCGG + Intergenic
1203296438 22_KI270736v1_random:46955-46977 TTCCGCCCGGTGGCGGGTGGGGG - Intergenic
950464598 3:13145791-13145813 GGGCGCCCGGGGGCGGGGGGGGG + Intergenic
951611693 3:24496884-24496906 TACCGCGGGGGGGCGGGAGGGGG + Intergenic
952816523 3:37452213-37452235 CGCCACCGGGGCGCGGACGGCGG - Exonic
952816692 3:37452761-37452783 CGGCGCCTGGAGGCGGGCGGGGG + Intronic
952877842 3:37962006-37962028 CATTGCCGGGGGGTGGGTGGAGG - Intronic
953165068 3:40457542-40457564 CGCCGCTGGCGAGCGCGTGGAGG + Intronic
953545079 3:43858358-43858380 GGCAGCAGGGGGGCGAGTGGGGG - Intergenic
953672714 3:44976182-44976204 CGCTGACGCGGGGCGGGGGGGGG + Exonic
953909176 3:46883186-46883208 CGCGGGAGGGGGGCGGGGGGCGG + Intronic
953974388 3:47371384-47371406 CGGCGGCGGGGTGGGGGTGGGGG - Intergenic
954468873 3:50674955-50674977 CGGCGCCGGGAGCCGGGCGGCGG + Intergenic
954645841 3:52131014-52131036 CGGGGTCGGGGGGAGGGTGGCGG + Intronic
954779067 3:53046013-53046035 CTCCGCCGGAGCGCGGGTGGAGG - Exonic
955400398 3:58587100-58587122 CGCCGCCGGGGGAAGGAGGGGGG + Intronic
956202278 3:66718993-66719015 GGCCGCTGGGGGGAGGGGGGGGG + Intergenic
959539453 3:107523389-107523411 CGCCGGCTGGGGCCGGGGGGCGG + Intronic
961827557 3:129606809-129606831 CGCAGCCCGGGGGCGGGGCGGGG + Exonic
962520748 3:136195853-136195875 CGCCGCCGGCGGGCGGGAGGGGG + Intronic
963870593 3:150410007-150410029 CGCCACCGGAGGGTCGGTGGTGG + Exonic
966182150 3:177197349-177197371 CGCCGCGGGGGGAGGGGCGGGGG + Intronic
966429993 3:179821100-179821122 AGCGGCGGGGCGGCGGGTGGGGG + Intronic
966808658 3:183825272-183825294 CGCCGCCGGGGCGCGGACCGGGG - Exonic
967087297 3:186107666-186107688 GGCGCCCGGGGCGCGGGTGGTGG - Intronic
967493654 3:190120428-190120450 CCTCGCCGGGGGGCGGGGGCGGG + Exonic
967684942 3:192408453-192408475 GGCGGCCGGGGGGCGGGGCGGGG + Exonic
967858253 3:194134269-194134291 CGCCGCCGGGTGCCACGTGGCGG - Intergenic
968092541 3:195908158-195908180 TGCCATCGGGGGGCAGGTGGAGG + Intronic
968093049 3:195909777-195909799 CGCCGCCCCGGGGTGGGGGGTGG + Intronic
968093053 3:195909780-195909802 CGCCCCGGGGTGGGGGGTGGGGG + Intronic
968096129 3:195932086-195932108 CGCAGCCTGGGGGTGGGTGAGGG - Intergenic
968230659 3:197003062-197003084 CGACACCGCGGGGCGGGCGGCGG + Exonic
968372783 4:11132-11154 CGGCGCCGGGGCGGGGGTCGGGG + Intergenic
968372796 4:11181-11203 CGGCGCCGGGGCGGGGGTCGCGG + Intergenic
968479205 4:826287-826309 CGGGGGCGGGGGGCGGGGGGTGG + Intergenic
968493657 4:903692-903714 CACCACCGGGGGGCGGTGGGGGG + Intronic
968727692 4:2255893-2255915 CGCTGCCGGGGAGCTGGGGGTGG + Intronic
969059555 4:4424202-4424224 CTACCCTGGGGGGCGGGTGGGGG + Intronic
969113362 4:4857066-4857088 CGCCGCGGGGGGGGGGGGGGGGG - Intergenic
969113366 4:4857069-4857091 CTCCGCCGCGGGGGGGGGGGGGG - Intergenic
969184672 4:5466236-5466258 AGCTGCCAGGGGGCGGGAGGCGG + Intronic
969330745 4:6472368-6472390 CGCGGCAGGGGGACGGGCGGGGG + Intronic
969597797 4:8158771-8158793 CGGAGCCGGCGGGCGGGCGGAGG - Intronic
970193096 4:13533500-13533522 CGTGGGTGGGGGGCGGGTGGGGG - Intergenic
970332825 4:15003027-15003049 CGCCGCCGGGGTGGTGGTCGGGG - Exonic
972312091 4:37891207-37891229 CGCCGCGGGGGGACGGGGAGGGG - Exonic
972631819 4:40848703-40848725 TGCGGCGGTGGGGCGGGTGGGGG - Intronic
972671459 4:41216413-41216435 CGGCGGCGGGGGGGGGGGGGGGG + Intronic
972686888 4:41360710-41360732 CGCCGGCCGGGGGCGGGGAGAGG + Intronic
973613512 4:52658777-52658799 CGTCCCCGGGGAGGGGGTGGGGG - Intronic
974047277 4:56908363-56908385 CCCCGCCGGGCGGGGGCTGGCGG + Intronic
977694345 4:99949939-99949961 CGCCGCTGGGGGCCGGCGGGCGG - Intronic
978384914 4:108168932-108168954 CGCCGGCGAGGCGCGGGAGGAGG - Intronic
979630755 4:122900052-122900074 GGGGGCCGGGGGGGGGGTGGCGG - Intronic
980130366 4:128811622-128811644 CGCCGCCCGGGCCGGGGTGGGGG + Intronic
981035078 4:140161067-140161089 CGCGGCCTGTCGGCGGGTGGGGG - Intergenic
981093479 4:140756344-140756366 CGCCGCCGTGGGCCGGGAGCCGG - Intergenic
981722477 4:147815466-147815488 CGGAGGCGGGGGGCGGGGGGAGG + Intronic
982134256 4:152258711-152258733 GGCAGGCGGGGGGCGGGCGGGGG - Intergenic
982712171 4:158768855-158768877 CCCCGGCGGGAGGCGGGAGGTGG - Intergenic
983752893 4:171298606-171298628 CGCCGCCGTGGAGCAGGGGGCGG - Intergenic
985462611 4:190121434-190121456 CGGCGCCGGGGCGGGGGTCGGGG - Intergenic
985539586 5:481883-481905 CGGGGCTGGGGGGCGGGGGGGGG - Intronic
985539643 5:482038-482060 CGGGGCTGGGGGGCGGGGGGGGG - Intronic
985549165 5:524486-524508 CTCCGCCCCGGGGCGGGAGGGGG - Intergenic
985655785 5:1130762-1130784 AGACGCAGGTGGGCGGGTGGTGG + Intergenic
985784460 5:1886703-1886725 CGGCGCGGGGCGGGGGGTGGGGG - Intronic
985784464 5:1886706-1886728 GGCCGGCGCGGGGCGGGGGGTGG - Intronic
985895502 5:2748363-2748385 CGCCGCCCGGGGACCGGTAGTGG + Exonic
986402803 5:7396097-7396119 CGCGGGCGGGGGCCGGGCGGCGG - Intergenic
988369292 5:30346028-30346050 AGCCCACGGGGGGCGGGGGGGGG - Intergenic
989229984 5:39074470-39074492 CGCCGCCGAGGGGGCGGGGGAGG - Intergenic
990557748 5:56952199-56952221 CTCCGCCGCCGGGCGGGTGCCGG - Intronic
991707106 5:69369227-69369249 CTCCGGGGGGGGGCGGGGGGGGG - Intronic
992226215 5:74621669-74621691 CGGGGGCGGGGGGCGGGGGGGGG - Intergenic
992365413 5:76084564-76084586 CGGCGCGCGGGGGCGGGGGGAGG + Intronic
992487517 5:77210635-77210657 CGCCGCGGCGGGGAGGGTGGCGG + Intronic
992716121 5:79513577-79513599 CGGCGGCGGGGGGCGGGAAGGGG - Exonic
992939917 5:81751429-81751451 CGGCGCGGGGGGAGGGGTGGCGG - Intronic
994769738 5:103966357-103966379 GGGCGCCGTGGAGCGGGTGGGGG + Intergenic
995650142 5:114361256-114361278 CCCCGGCCGGGGGTGGGTGGGGG - Intronic
995650405 5:114362357-114362379 CGCCGCCGGGGCACCGGAGGAGG - Exonic
996329430 5:122312307-122312329 CGCCGCGGGGAGGCGGGAGGCGG + Intronic
996552793 5:124747631-124747653 CACTGCGGGGGGGCGGGGGGAGG - Intronic
997292396 5:132747392-132747414 CGCCGCCGGGGGAGGTGGGGAGG - Intergenic
998018845 5:138753377-138753399 CGCGGGCGGGGGGCGGGCCGGGG + Intronic
998369486 5:141651555-141651577 CGCCGGCAGGGTCCGGGTGGCGG + Intergenic
998583513 5:143403852-143403874 CGCCGTCGGGGCCGGGGTGGCGG - Intronic
999782135 5:154858184-154858206 CGCCCACGGCGGGGGGGTGGGGG + Intronic
1000205191 5:159051441-159051463 AGCCGCCGGGCGGCGGGGTGGGG - Intronic
1000391411 5:160726932-160726954 AGCCCCCGGGGGTGGGGTGGGGG + Intronic
1001424857 5:171616344-171616366 CGGAGCCAGGGGGCGGGGGGAGG - Intergenic
1001824228 5:174732885-174732907 CACCGGCGGGGGGCGGGGGGGGG - Intergenic
1002006400 5:176238327-176238349 CGCCGCCGGTGGGCGGGGCTTGG + Intergenic
1002131919 5:177087115-177087137 AGCCGCCAGGGGGCGAGAGGCGG + Intronic
1002219980 5:177672310-177672332 CGCCGCCGGTGGGCGGGGCTTGG - Intergenic
1002296149 5:178232466-178232488 CCCGGGCGGGGGGCGGGCGGCGG - Intronic
1002298907 5:178246715-178246737 TGCAGACGGGGGGCGGGGGGGGG + Intronic
1002306809 5:178288433-178288455 AGCTGTCGGGGGGCGGGTGTGGG - Intronic
1003139520 6:3458366-3458388 GGCTGCCGGGGGGCGGGTCTTGG + Intergenic
1003624099 6:7727066-7727088 CGCCGCCGGGGGGCAGCTGCTGG + Exonic
1004140529 6:13013746-13013768 CGCCGCGGCGGGGCGGGTCGGGG - Intronic
1004396343 6:15248824-15248846 CGCGGCGGGGCGGCGGGGGGAGG + Intronic
1004561969 6:16760568-16760590 CGCGGCCGGGTGCCGGGCGGGGG - Intronic
1004924375 6:20403433-20403455 CGTCGCCGGGGGGCGGAGAGGGG - Intronic
1005987682 6:30884569-30884591 CGCCGGCGGGGCTCGGGTGTCGG - Intronic
1006180387 6:32150518-32150540 CGCCGGCGGGGGCGGGGCGGCGG + Exonic
1006341881 6:33451841-33451863 TGCAGCCGGGGTGGGGGTGGTGG - Exonic
1006472713 6:34237476-34237498 CGCGGCGCGGGGGCGGGCGGCGG + Intronic
1006498262 6:34439855-34439877 CGCCGCTGCTGGGCGGGGGGGGG - Intergenic
1006512125 6:34527173-34527195 CTGCGCCGCGGGGCGGGGGGCGG + Intronic
1006512128 6:34527176-34527198 CGCCGCGGGGCGGGGGGCGGGGG + Intronic
1006717679 6:36130714-36130736 GGCCGCTGGGGGGCGGGGGGCGG + Intronic
1007431512 6:41779902-41779924 CGCGGCCGCGGGGCGGGGCGGGG - Intronic
1007656836 6:43455633-43455655 CGTCGCGGGGGGGGGGATGGGGG - Intronic
1008649021 6:53544797-53544819 CGCCGCCGGGGAGCCGGAGCGGG - Exonic
1010032811 6:71288565-71288587 GGCCGCCGGGGGCCGCGTGAAGG + Intergenic
1011195468 6:84774858-84774880 CGCCGCCGGGCACCGGGCGGGGG + Intergenic
1011640443 6:89412198-89412220 CTCCGCCGGCGGGCGGGGCGGGG - Exonic
1012912902 6:105137234-105137256 GCCCGCCGGGGGGCGCGGGGCGG - Intergenic
1013069592 6:106716514-106716536 CGGTGGCGGGGGGCGGGGGGGGG - Intergenic
1014079524 6:117270808-117270830 CGGCGGCGGGGCGCGGGTAGGGG - Exonic
1015440586 6:133241906-133241928 CGTCCCCGGGGGGCGCTTGGAGG + Intronic
1015525855 6:134175135-134175157 CGCCGGCGGAGGGCGCGGGGAGG + Intronic
1015859063 6:137656537-137656559 CGGGGCCGGGGGGCGGGTTAAGG - Intergenic
1015935646 6:138404229-138404251 CGCCGCGGAGGGGCGGGGGCAGG + Exonic
1017738235 6:157381970-157381992 CGCGGCCGGGGGGCTCCTGGGGG + Exonic
1017793903 6:157823877-157823899 CGCCCCCGCGGGGCGGGTGGGGG + Intronic
1017902550 6:158730863-158730885 AGCCGCCAGGGGGCGGGTCGGGG + Intronic
1018062778 6:160103637-160103659 CACCACCAGGGGGCTGGTGGTGG - Intronic
1018890107 6:167976996-167977018 TGCCGGCGGGGAGCGGGCGGTGG + Intergenic
1018945650 6:168345711-168345733 GGCAGCCGGGGGGCAGCTGGGGG + Intergenic
1018945665 6:168345743-168345765 GGCAGCCGGGGGGCAGCTGGGGG + Intergenic
1019343639 7:519682-519704 AGGCCCCGGGCGGCGGGTGGTGG - Intronic
1019421989 7:954828-954850 CGCGGATGGGGGGCGGGCGGCGG - Intronic
1019426956 7:982497-982519 GGCTGCCGGGTGGCAGGTGGCGG - Intergenic
1019478586 7:1255714-1255736 CCCCGCCGGCGGGCAGGTGTCGG + Intergenic
1019538367 7:1540376-1540398 TGCCGGCCGGGGGCGGGGGGTGG + Exonic
1020130493 7:5556328-5556350 CGCGGGCCGGGGGCGGGAGGGGG - Intronic
1020136944 7:5592887-5592909 CGGCCCCGGGAGGTGGGTGGCGG - Exonic
1020494472 7:8831685-8831707 CTCCAGCGGGGGGCGGGTGTAGG - Intergenic
1021120168 7:16789688-16789710 CTCCGCCGGGAGGGAGGTGGGGG - Intergenic
1021998477 7:26202108-26202130 CTCCGCCGGAACGCGGGTGGGGG - Intronic
1022942532 7:35254198-35254220 CGCCGCCGGGGGCGGGGCCGCGG + Intergenic
1023827488 7:44019325-44019347 CCAAGCCGGGGTGCGGGTGGGGG - Intergenic
1023842233 7:44104225-44104247 GGCTGCGGGGGGGCGGGGGGCGG - Intergenic
1023970586 7:44987860-44987882 CTCTGCCTGGGGGTGGGTGGGGG - Intergenic
1024043825 7:45574471-45574493 GGGCGCCGGGGCGCGGGCGGCGG - Intronic
1024247193 7:47479483-47479505 CACCGCCGACGGGGGGGTGGGGG - Intronic
1025069783 7:55887848-55887870 CGGCGGCGGGCGGCGGGCGGCGG + Intronic
1025829784 7:65038701-65038723 CGGGGCCGGGTGGGGGGTGGCGG + Intergenic
1025976758 7:66376642-66376664 GGCCGCCGGGAGGCGGGAGCTGG + Intronic
1026822291 7:73557647-73557669 CGGCGGCGGCGGGCGGGCGGCGG - Exonic
1027228599 7:76260041-76260063 GGCCGCCGCGGCGGGGGTGGGGG + Intronic
1027265995 7:76495583-76495605 GGCCTCCTGGGGGCTGGTGGTGG + Intronic
1027317369 7:76993700-76993722 GGCCTCCTGGGGGCTGGTGGTGG + Intergenic
1029024762 7:97404518-97404540 TGCTGCCAGGTGGCGGGTGGCGG + Intergenic
1029080947 7:97973482-97973504 TGACGGCGGGGGGTGGGTGGTGG - Intergenic
1029440877 7:100586052-100586074 CGCCGCCGGGGGTGAGGAGGCGG - Exonic
1029640330 7:101816179-101816201 AGCCGCCGGGGGGCCCGCGGCGG + Intronic
1029640455 7:101816512-101816534 GGGCGGCGGGGGGCGGGCGGCGG + Intronic
1029832922 7:103280053-103280075 CCCCGCCCGGGAGCGGGAGGTGG - Intergenic
1030598025 7:111562423-111562445 CGGCGTCCGGCGGCGGGTGGGGG - Intronic
1031966469 7:128031324-128031346 CGCCGCCGGAGGGAGTGCGGGGG + Intronic
1032013802 7:128363293-128363315 GGGCGGCGGGGGGCGGGTGCTGG + Intergenic
1032781495 7:135168293-135168315 TGCCGGGGGGGGGCGGGGGGGGG - Intronic
1033239919 7:139669640-139669662 CACAGCCAGTGGGCGGGTGGGGG + Intronic
1033361286 7:140640579-140640601 CGCGGCTCGGGGGCGGGCGGCGG + Exonic
1033657043 7:143381459-143381481 CGCCGGGAGGGGGCGAGTGGGGG + Intronic
1034306379 7:150048056-150048078 AGCCGCCGGGGAGGGGGCGGAGG - Intergenic
1034335913 7:150323431-150323453 GGCCGCCAGGCGGCGGGCGGCGG + Exonic
1034455531 7:151167892-151167914 GGGCCGCGGGGGGCGGGTGGGGG - Intronic
1034469716 7:151248744-151248766 CGGCGGCGGCGGGCGGGCGGCGG - Exonic
1034522706 7:151632543-151632565 CGGCGCCGGGGGGCGGAGTGGGG - Intronic
1034620284 7:152451662-152451684 CTGCGGCGGGGGGCGGGGGGGGG - Intergenic
1034800467 7:154052586-154052608 AGCCGCCGGGGAGGGGGCGGAGG + Intronic
1034967069 7:155398235-155398257 CGGAGGCGGGGGGCGGGGGGCGG + Intergenic
1035431830 7:158828814-158828836 CGGGGCCGGGGGGCGGGGCGGGG + Intronic
1037789029 8:21920117-21920139 CTTCACCGGGGGGCGGGCGGGGG - Intronic
1038008821 8:23457657-23457679 TGCCGGCGGGGGCCGGGCGGGGG - Exonic
1038828625 8:31033359-31033381 CGACGGCGGGGGGCGGGCGGTGG + Exonic
1039518454 8:38152084-38152106 AGTCGCGGGGGGGCGGGGGGGGG + Intergenic
1039567973 8:38564739-38564761 GGCCGGTGGGGGGCCGGTGGGGG - Intergenic
1039608591 8:38901710-38901732 CGCCGCCAGGGGTCGGGCTGCGG + Intronic
1039816736 8:41101010-41101032 CTCCGCAGGGGGTCAGGTGGGGG - Intergenic
1040471541 8:47738579-47738601 TGTCGCCGGAGGGCGGGGGGTGG + Exonic
1040550876 8:48436509-48436531 CTCCTCCGTGGGGCGGGTGCTGG - Intergenic
1041792507 8:61713796-61713818 GGGCGCCGGGGGGCAGGGGGAGG - Intronic
1042216327 8:66432424-66432446 CGCGGCCGAGGGGCGGGAGGCGG + Intronic
1042307182 8:67343868-67343890 CGGCGCCGGGAGGCTGGGGGCGG + Intergenic
1043388418 8:79768919-79768941 GGCCGCCGGGGGGAGGGGGCGGG - Intergenic
1044335980 8:90985241-90985263 CGGCGGCGGGGGGCGAGGGGCGG + Exonic
1044591441 8:93917266-93917288 GGCCGTCGGGGGGCTGGGGGCGG + Intronic
1044819256 8:96144930-96144952 CGCCGCCGGCGGCCGGGCGAGGG + Exonic
1046278548 8:111993664-111993686 TGGCGGCGGGGGGCGGGCGGTGG + Intergenic
1047998471 8:130358246-130358268 CCAGGCCGGGCGGCGGGTGGCGG - Intronic
1048872601 8:138811869-138811891 GGCCGCTGGGGTGGGGGTGGAGG + Exonic
1048980939 8:139703211-139703233 CGCCACCGCGAGGCGGCTGGCGG + Intergenic
1049541712 8:143211728-143211750 GGGCGCAGGGAGGCGGGTGGGGG + Intergenic
1049620937 8:143598009-143598031 CGCGGCCCGGGCGCGGGGGGCGG - Exonic
1049762277 8:144336908-144336930 CGGCGGCGGCGGGCGGGGGGCGG + Intergenic
1050155949 9:2666727-2666749 AGCGGCCGGGGGCGGGGTGGGGG - Intergenic
1050537726 9:6645215-6645237 GGCCGCGGAGGGCCGGGTGGAGG + Intronic
1051184376 9:14443027-14443049 CATGGCGGGGGGGCGGGTGGGGG - Intergenic
1051894608 9:21974749-21974771 CGCGGCCCGGGGTCGGGTAGAGG - Exonic
1052991904 9:34523333-34523355 TGCCGGCGCGGGGCGGGAGGAGG + Intergenic
1053050482 9:34957828-34957850 CCGCGCCGGGGGTTGGGTGGGGG - Intronic
1053072931 9:35111614-35111636 GGCCGCCGCGGCGCGGGTGGTGG - Intronic
1053203141 9:36166190-36166212 CGCCGCGGGCGGGAGGGAGGGGG - Intergenic
1053409144 9:37904271-37904293 CGCCGCGGCGGGGCAGGTAGAGG + Intronic
1053540413 9:38968039-38968061 TGGTGCCGGGCGGCGGGTGGGGG - Intergenic
1053804762 9:41790197-41790219 TGGTGCCGGGCGGCGGGTGGGGG - Intergenic
1054407212 9:64773326-64773348 CGTCGGCGGGGGGGGGGGGGGGG + Intergenic
1054407727 9:64775086-64775108 CTGCGGCGGGGGGGGGGTGGGGG + Intergenic
1054489413 9:65762585-65762607 CGGCGGCGGGGGGGGGGTGGGGG - Intergenic
1054625727 9:67395884-67395906 TGGTGCCGGGCGGCGGGTGGGGG + Intergenic
1055090987 9:72364796-72364818 CGCCGCCGCGGGCCGGGAGCGGG + Intronic
1057432149 9:95004699-95004721 CGGAGCCGGGGGAGGGGTGGCGG + Intronic
1057547027 9:96026420-96026442 CGCCGCAGTGGGGCGGGGGTGGG + Intergenic
1059474407 9:114532837-114532859 CGGGGGCGGGGGGCGGGGGGAGG + Intergenic
1059698648 9:116753988-116754010 CGCAGCAGGGGCGGGGGTGGGGG - Intronic
1060096298 9:120793478-120793500 CCCCGCCCGGAGGTGGGTGGTGG + Intergenic
1060106783 9:120877442-120877464 CGCGCCCGCGGGGCGGGCGGGGG - Intronic
1060478127 9:124000175-124000197 CAGGGCCGGGGGGCGGGGGGCGG - Intergenic
1060814323 9:126626778-126626800 CACCGCCGCGGGGCTGGGGGTGG - Intronic
1060917939 9:127402537-127402559 AGCCTGCGGGGGGTGGGTGGAGG - Exonic
1061309526 9:129753119-129753141 CGCTGCCGTGGGGCGGGGCGTGG - Intergenic
1061825579 9:133256425-133256447 GGCCGCTGGCGGGCGGGTGCAGG - Intronic
1062022552 9:134326344-134326366 CGCCGGCGGGGGGGTGGCGGGGG - Intronic
1062022555 9:134326347-134326369 CGGCGCCGGCGGGGGGGTGGCGG - Intronic
1062084510 9:134641853-134641875 CGCCCACGGGGAGCGGGTCGCGG + Exonic
1062144348 9:134980628-134980650 GGTGGCCGGGGGGCAGGTGGGGG + Intergenic
1062162474 9:135087840-135087862 CGGCGGCGGCGGGCGGGCGGCGG + Exonic
1062332725 9:136051608-136051630 AGGCGCCGGGTGGCGGGAGGAGG + Intronic
1062562019 9:137145914-137145936 CGCCGCGGGTGGGCGCCTGGCGG + Intronic
1062566914 9:137167642-137167664 CGCAGCCTGGGGGAGGCTGGGGG - Intronic
1062574452 9:137199916-137199938 CGGGGCTGGGGGGCGGGTGGAGG + Exonic
1062656110 9:137605333-137605355 CGCGGCCGGGGGGCGGGGCAGGG + Intergenic
1203771159 EBV:50726-50748 GGCCGTGGGGAGGCGGGTGGCGG + Intergenic
1203468303 Un_GL000220v1:105976-105998 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1203469340 Un_GL000220v1:109335-109357 CCCGGCCGGGGGGCGGGCGCCGG + Intergenic
1203476124 Un_GL000220v1:149948-149970 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1203477161 Un_GL000220v1:153307-153329 CCCGGCCGGGGGGCGGGCGCCGG + Intergenic
1185457164 X:317034-317056 CGCAGCCGAGTGGCAGGTGGCGG - Exonic
1185889889 X:3814638-3814660 CGGGGCCTCGGGGCGGGTGGCGG - Intergenic
1186207831 X:7218541-7218563 CATCGCCTGGGGGCAGGTGGAGG + Intergenic
1188003473 X:25002511-25002533 CGCGGCCGAGGGGAGGGTGCAGG - Intergenic
1188451099 X:30308848-30308870 CACGGCCAGGGGGCGCGTGGTGG - Exonic
1189037102 X:37505055-37505077 CGCCGTCGGGTGGATGGTGGTGG - Intronic
1189354235 X:40299101-40299123 CGGGGGCGGGGCGCGGGTGGGGG + Intergenic
1190885789 X:54530151-54530173 CTCCGCGGGGGGGGGGGGGGGGG - Intergenic
1192447651 X:71222978-71223000 GGCCACGGGGGGGCGGGGGGAGG - Intronic
1196393516 X:115234118-115234140 CGCAGACTGGGGGCGGGGGGTGG + Intergenic
1197199015 X:123732833-123732855 CGCCGCCCGGGTGGGGGAGGGGG + Intronic
1198657676 X:138932503-138932525 CGGCGCGGGAGGGCGGGGGGTGG + Intronic
1198712382 X:139519548-139519570 TGCTGTTGGGGGGCGGGTGGGGG - Intergenic
1200098172 X:153673830-153673852 GGCCGGCGGGGCGCGGGCGGGGG - Intronic
1200100944 X:153688884-153688906 CGGCTCCGGGGGTCGGGCGGGGG - Intronic
1200155440 X:153972426-153972448 CGCCGCGGGGGAGCCGGGGGCGG + Exonic