ID: 942241107

View in Genome Browser
Species Human (GRCh38)
Location 2:173964673-173964695
Sequence CGCCGCCGCCGGGGGGCGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 722
Summary {0: 1, 1: 0, 2: 9, 3: 78, 4: 634}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942241107 Original CRISPR CGCCGCCGCCGGGGGGCGGG TGG (reversed) Intronic
900032556 1:381736-381758 GGCCGCCGCGGTGGGGTGGGCGG - Intergenic
900053313 1:610798-610820 GGCCGCCGCGGTGGGGTGGGCGG - Intergenic
900091967 1:924562-924584 CGAGGCGGCCGGGGGGAGGGCGG - Intergenic
900095979 1:940303-940325 CGGCTCCGCGGCGGGGCGGGGGG - Intronic
900129014 1:1079801-1079823 CGTCGCAGCCAGTGGGCGGGAGG + Intergenic
900147889 1:1166352-1166374 CGCCTCTGCAGGGGGGCAGGAGG - Intergenic
900180124 1:1307648-1307670 CGCGGCCGCCGGGGAGGGGCTGG - Intronic
900226635 1:1536191-1536213 CTCCGCGGCCCCGGGGCGGGCGG - Intronic
900240771 1:1616226-1616248 CGCCGGCGCAGGGGAACGGGCGG - Intronic
900269171 1:1778415-1778437 CGCCGGCGCCGGGGTCCGGGCGG - Intronic
900349723 1:2228642-2228664 AGCCGGCGGCGGGGGGCGGCCGG + Intergenic
900349739 1:2228677-2228699 GGGCGCCGCCGGGGCGCGCGGGG + Exonic
900366928 1:2315213-2315235 CGCCGCCTCCGCGGGGCCTGGGG - Intergenic
900786944 1:4655287-4655309 CCCCGCGGCCGGCGGGCGGCGGG + Exonic
900786947 1:4655290-4655312 CGCGGCCGGCGGGCGGCGGGAGG + Exonic
901057528 1:6455588-6455610 CGCCGCCGTCCAGGGGCGGCAGG - Intronic
901086690 1:6615072-6615094 GGCTGCCGCGGGAGGGCGGGTGG + Intronic
901629021 1:10639238-10639260 CGCCGCCCCCGGGCCGCGCGAGG - Exonic
901641357 1:10694638-10694660 CTCCGGCACCGGGCGGCGGGCGG - Intronic
902336814 1:15758821-15758843 CGGAGCCGCCGGGGCGCGGGCGG + Intronic
902920825 1:19665252-19665274 CCCCGCGGCCGGTGGGCGTGTGG - Intergenic
903263570 1:22143515-22143537 AGGCGCCGGCGGGGGGCGGTGGG - Intronic
903555128 1:24187419-24187441 CCCCGCCGCGGGGGGAGGGGGGG + Intronic
904181401 1:28668997-28669019 CGCCGCCGCCGGGGAGCGAGCGG + Intronic
904181416 1:28669026-28669048 CGGCGCCGCGGGGGGGTGGGGGG + Intronic
904500157 1:30908601-30908623 CGCGGGCGGCGGGCGGCGGGCGG + Exonic
904641946 1:31937935-31937957 CGCCGGCGCCGGGGGCCTCGGGG - Intronic
904724854 1:32539588-32539610 CGGCGCCGGCGGAGGGCGGGCGG + Intronic
904724979 1:32539950-32539972 GGCCGCCGCGGGGGCGCGCGGGG + Intronic
904775134 1:32901554-32901576 CGCCGCCGCCGGTGGGCTGAGGG - Intergenic
905182657 1:36176494-36176516 CGCCCCCGCCGGTGAGCGCGGGG + Exonic
905183189 1:36178853-36178875 CGCGGGCGCCGCGGGCCGGGAGG + Intronic
905449004 1:38045433-38045455 CGCCGCCGGCGGGGGCGGTGGGG + Exonic
905580700 1:39081366-39081388 CGCTGCCGCTAGGGCGCGGGGGG + Intronic
905680892 1:39869916-39869938 CGCCCCGTCCGGGAGGCGGGGGG + Intronic
906168956 1:43707760-43707782 CGCGGCCGGCGGGGGAGGGGCGG - Intronic
906325583 1:44843371-44843393 CGGCGCCGCAGGGGGCGGGGCGG + Intergenic
906480955 1:46198478-46198500 CGCCGCTGCCGCGGGGTGAGAGG + Intronic
906495784 1:46303054-46303076 CCCAGCGGCCGGGGGGCGCGGGG - Intronic
907010636 1:50959900-50959922 CGCCGCCGCCGGGCGCCGAGGGG + Exonic
907429931 1:54405902-54405924 CGCCGCCGCCGGGCTGCGGGCGG - Intronic
908131839 1:61082370-61082392 CGCCGCCGCCGCGGGGGGGAGGG - Intronic
908193295 1:61725156-61725178 CGCCTCCGCCCAGGAGCGGGAGG + Intronic
908501113 1:64744906-64744928 CGCCGGGGCCGGGGGCCGGCGGG + Intergenic
909012903 1:70354409-70354431 CGCCGCCGCCAGGGGCAAGGGGG + Exonic
910876822 1:91885945-91885967 CGCCGCCGCCGAGCGCTGGGCGG - Exonic
911348138 1:96721681-96721703 CGCCGGCGCCCGGCAGCGGGAGG - Intronic
912492719 1:110070737-110070759 CGCGGGGGGCGGGGGGCGGGGGG + Intronic
913069583 1:115286622-115286644 CGCCGCTGCCGGGGCGCTGCGGG + Exonic
914044322 1:144078000-144078022 CGCGGCGGCGGGGGGGGGGGGGG - Intergenic
914703074 1:150150786-150150808 GGCTGCGGCCGGGGGGCGGGGGG - Intronic
914753112 1:150549218-150549240 CGCAGCCGTCGGGGGGCGCCCGG + Intergenic
914908934 1:151769249-151769271 CGCCCCCTCCGGGAGGTGGGGGG - Intronic
915213297 1:154325490-154325512 GGCGGGGGCCGGGGGGCGGGAGG - Intergenic
915213301 1:154325497-154325519 AGCCGGCGGCGGGGGCCGGGGGG - Intergenic
915213402 1:154325769-154325791 GGCCGCAGCCGCGGGGCTGGAGG + Intronic
915310235 1:155002742-155002764 GGCGGCCGAGGGGGGGCGGGCGG + Exonic
915310456 1:155003691-155003713 CGCCGGCGCCGGTGGGGGGACGG - Intronic
915740252 1:158113683-158113705 GGCGGCCGCCGGGGGGCGCCGGG - Intergenic
916315852 1:163446852-163446874 GGCCGAGGCCGGGGGGCGTGTGG - Intergenic
919699871 1:200620810-200620832 CGGCACTTCCGGGGGGCGGGTGG - Intergenic
919748663 1:201023590-201023612 CGCCGCCGCCCGATGGCGCGAGG - Exonic
919809396 1:201399327-201399349 GGCGGCCGGCGGGGCGCGGGCGG - Exonic
920367762 1:205457050-205457072 CGCCGCCGCCGGAGGCCGCGCGG + Intergenic
920886864 1:209938107-209938129 CGCCGCGGGCGGGGCGAGGGAGG - Intergenic
921472666 1:215567558-215567580 GGCGGCGGCCGGAGGGCGGGGGG - Exonic
922134837 1:222814902-222814924 CGCCGGCGGCGGGCGACGGGCGG - Intergenic
922558258 1:226549142-226549164 CCCCGCCGCGGGAGGGCGTGGGG + Intronic
922739364 1:228006869-228006891 CGCCGGGGCCGGGGCCCGGGCGG - Intergenic
923141072 1:231162144-231162166 CGCTGCAGCCGGCGGGCGGAGGG - Intronic
924527147 1:244863302-244863324 AGCCGCGGGCGGGCGGCGGGAGG - Intronic
1062774475 10:134736-134758 CGCCGAGGCCGGGGCGCGAGGGG - Exonic
1062890553 10:1056718-1056740 CGGCGCCGCCGGGTGTGGGGCGG + Intronic
1063504013 10:6580170-6580192 CGCCGCCGCCGGGAGGGAGCGGG - Intronic
1063664094 10:8051499-8051521 CGCCGCCGCCGCAGGGCCCGGGG - Intergenic
1065099864 10:22321787-22321809 CGGCGCGGCCGGGGCGCGGGGGG - Intronic
1065343018 10:24723776-24723798 GGCCGCCGCAGGAGGGCGTGGGG + Intergenic
1067300230 10:45001119-45001141 GGCCGCCGGGCGGGGGCGGGAGG + Intronic
1067711829 10:48656256-48656278 CGGCGCCTCTGGGGGGGGGGGGG + Intronic
1069909015 10:71748693-71748715 TGGCGCCTCCAGGGGGCGGGAGG - Exonic
1072059740 10:91798476-91798498 CTCCGCCGCCGCGGGGCAGCCGG + Exonic
1072059744 10:91798479-91798501 CGCCGCCGCGGGGCAGCCGGGGG + Exonic
1072169852 10:92848664-92848686 AGCGGCCGGCGTGGGGCGGGGGG - Intronic
1072294176 10:93993818-93993840 CGCCACCGCGGGCGGCCGGGCGG - Intergenic
1072562298 10:96587117-96587139 CACCGCCGCCGGGCCGAGGGAGG + Intronic
1073147815 10:101292063-101292085 CGCTGCCCCGCGGGGGCGGGAGG - Intergenic
1073325572 10:102642670-102642692 CGCCGCCGCCGCGAGGAAGGCGG - Intergenic
1073577832 10:104640567-104640589 CGCCCCCGCGCGGGGGCGTGGGG - Intergenic
1074399082 10:113126887-113126909 CGCGGCCGGCGGCGGGCGGGCGG + Intronic
1075031940 10:119029749-119029771 CGCCGCCGGCGCGGGCCGGACGG - Exonic
1075031967 10:119029825-119029847 CGCGGCCGCGGCGGGGCGAGCGG - Exonic
1075048620 10:119165668-119165690 CGCCGCCGCCAGGCCGCGCGTGG + Intergenic
1075054321 10:119206868-119206890 CGCGGCCGGCGGGGGGCGCTCGG + Intergenic
1075892931 10:125970214-125970236 CGCCCCCTCTGGGGGGTGGGGGG - Intronic
1076374234 10:129972834-129972856 CGCGGCCGCCTGGGGGCCGCGGG + Intergenic
1076792871 10:132786086-132786108 CGGCTCCGGCGCGGGGCGGGCGG + Intergenic
1076895367 10:133308845-133308867 CGCCGCCGTCGGGGGCTGCGCGG - Exonic
1076902144 10:133344949-133344971 CGGAGCGGCCGGGTGGCGGGAGG - Intronic
1076977907 11:189483-189505 CGCGTCCCCTGGGGGGCGGGGGG + Intronic
1076992102 11:280718-280740 CGCCGCCCCCGGGAGGCTGCAGG + Exonic
1077047027 11:551221-551243 CTCAGCCGCGGGGGGGCCGGTGG - Exonic
1077065537 11:639560-639582 CGGGGGCGCCGGGGCGCGGGCGG - Intronic
1078102411 11:8337629-8337651 TGACGACGGCGGGGGGCGGGGGG + Intergenic
1078561722 11:12378050-12378072 CGCCCCCGCCGGGCCGTGGGCGG + Intronic
1078771764 11:14358629-14358651 GGCCGGGGCCAGGGGGCGGGAGG - Intronic
1079035187 11:17014414-17014436 CGGAGCCGCCGCGGGGTGGGGGG + Intronic
1079126237 11:17720328-17720350 CGCCGCGGCCCGGGGGCAGCGGG - Exonic
1080540270 11:33257911-33257933 CGCCGCCACCCCGGGGTGGGGGG + Intronic
1081672712 11:44950610-44950632 CGCAGGCGGCGGGCGGCGGGAGG + Intronic
1081700061 11:45147040-45147062 CGGCGCCGGCGCGGGGTGGGGGG + Intronic
1081700062 11:45147043-45147065 CGCCGGCGCGGGGTGGGGGGCGG + Intronic
1081831509 11:46119972-46119994 CCCCGCCGCCGGCGGCCGCGGGG - Intronic
1081872954 11:46391585-46391607 CGCGGCGGCGCGGGGGCGGGGGG - Intergenic
1083039123 11:59669070-59669092 CGCCGCCGCCGGGCGCCGAGCGG - Intergenic
1083265762 11:61546206-61546228 GGCCGCCGCGGCGGGGCTGGCGG - Exonic
1083272872 11:61580882-61580904 CGCCGCCGCCGCTGGGCATGGGG + Intronic
1083457108 11:62786686-62786708 CGCTGCCGCCAGGGGGCGCGGGG + Exonic
1083617966 11:64035779-64035801 CGCCGCCGCCGCGAGGGGAGAGG + Intronic
1083618166 11:64036379-64036401 CCCCGCCGCGGGGAGGCGCGGGG + Intronic
1083849199 11:65355353-65355375 TGACGCCGCTGGGGGGTGGGAGG - Intronic
1083936587 11:65872806-65872828 CGCCGCGGCAGGCGGGCGGGCGG - Exonic
1084153944 11:67303646-67303668 CGCCGCTGCCCGGGGGCGAACGG - Exonic
1084650557 11:70486925-70486947 GGCCGCGTCCTGGGGGCGGGTGG + Intronic
1085399042 11:76224631-76224653 CCCCGCCGCAGGGGTGAGGGAGG - Intergenic
1085666217 11:78417612-78417634 CGCGGCCGCCCAGGGGCGGGCGG - Intronic
1086981066 11:93198018-93198040 CACCGCCGGCGAGGGGCGGGAGG + Intergenic
1087076215 11:94129094-94129116 CGCCGCCGGCGGGGCGGGGCGGG - Exonic
1087117998 11:94544531-94544553 CGACGGCGGCGGCGGGCGGGCGG + Exonic
1088893465 11:114061251-114061273 CGCGGGCGCCGAGCGGCGGGTGG + Intronic
1089198183 11:116707563-116707585 CGCCGCGGGTGGGGTGCGGGAGG - Intergenic
1089432698 11:118436673-118436695 CGCCACAGCCGGGGGGGAGGGGG - Exonic
1090344991 11:126062651-126062673 CGCCGCCGCGCGCGCGCGGGGGG - Intronic
1090978391 11:131695037-131695059 CGCCGCCGCCGGGAGGGTGCAGG + Intronic
1091381795 12:66747-66769 CGGCGCCGGCGGGGGGAGGGAGG + Exonic
1091393335 12:138980-139002 AGCCCCCGCCGTGGGCCGGGAGG + Exonic
1091616088 12:2052578-2052600 CGCCGCCGGCGGGGCGCGAGGGG + Intronic
1091616124 12:2052689-2052711 CCCGGCCGCCGGCGGGCGAGGGG - Intronic
1092743165 12:11649551-11649573 GGCGGCCGCGGGGGCGCGGGCGG - Intergenic
1095206161 12:39442892-39442914 TGCCGGCGGCGGGCGGCGGGCGG - Intronic
1095954168 12:47797034-47797056 GGCCGCCGCCGGAGGCTGGGGGG + Exonic
1095971686 12:47905732-47905754 CGCCGATGCCACGGGGCGGGGGG - Intronic
1096077642 12:48815146-48815168 AGCCGCCGCCGGAGGATGGGCGG + Intronic
1096221070 12:49828373-49828395 GGCCGCGGCTTGGGGGCGGGGGG + Exonic
1096241327 12:49961797-49961819 GGCCGGCGCGGGGGGGCAGGGGG - Intergenic
1096482473 12:51951788-51951810 CGCCGCTGCCGGCGAGCAGGAGG - Exonic
1096695261 12:53344801-53344823 CGGCGCGGCCGAGGGGCGGGCGG + Intronic
1096773965 12:53953078-53953100 GGCCGGCTCCTGGGGGCGGGAGG + Intergenic
1096977117 12:55705965-55705987 CTCTGCTGCTGGGGGGCGGGGGG - Intronic
1096983734 12:55743390-55743412 CGCCGCCGCCGCGGGGCCCTCGG - Exonic
1097085918 12:56468459-56468481 AGGCGACGCCCGGGGGCGGGCGG - Intronic
1097155123 12:57006603-57006625 CGCTGCGGCCGGGCGGCGGGGGG - Intergenic
1097191180 12:57220332-57220354 CGCCGGCTCCGGGGCGCGGTGGG - Intronic
1097264414 12:57737508-57737530 CGCCGCCGCCGCCGGGGGAGGGG - Exonic
1097787779 12:63780051-63780073 CGCCGCCGCCAGGCGCCGGCCGG + Exonic
1097891348 12:64780751-64780773 GGCCGGCGCCGCGAGGCGGGAGG + Intergenic
1098029049 12:66235412-66235434 GGCCGCCGCCGCGCGGCGAGAGG - Intronic
1098333093 12:69375050-69375072 CGCCCCCTCCGGGAGGTGGGGGG - Intronic
1099989558 12:89708559-89708581 CGCCCCCGGCCGCGGGCGGGCGG + Intronic
1099989753 12:89709259-89709281 CGCCGCCAGCGTGGAGCGGGAGG - Intronic
1100315484 12:93441496-93441518 CGCGGCCTCCGGCGGGGGGGTGG + Intronic
1102101277 12:110281016-110281038 CGCCGCGGTCGCGGGGCTGGCGG - Intronic
1102197137 12:111033926-111033948 CGCGCCCTCCGGGGGTCGGGGGG + Intergenic
1102853871 12:116277246-116277268 CGCCGCCGGGGGAGGGCGCGAGG + Exonic
1103400725 12:120641167-120641189 CGCTGCCGCCGGCCCGCGGGCGG + Exonic
1104029364 12:125053517-125053539 CGCCCCGTCCGGGAGGCGGGGGG - Intergenic
1104030860 12:125065253-125065275 GCCCGCGGCCGGGGGGCGTGGGG - Intergenic
1104429679 12:128706052-128706074 AGCCGACTCCGGGGGGCGGCAGG + Exonic
1104929257 12:132329484-132329506 CGGGGGCGCCGGGGGGCGGCGGG + Intergenic
1105502879 13:20988334-20988356 CTCCGCAGCCGGGGCGGGGGCGG + Exonic
1106517081 13:30465180-30465202 GGCGGCGGCCGGGCGGCGGGGGG - Intronic
1110597018 13:77329907-77329929 GGCTGCAGCCGGGGGGCGTGGGG + Intergenic
1110630255 13:77698401-77698423 GGCCGGAGCCGGGGGGCGCGGGG + Intronic
1110887258 13:80655165-80655187 CGCCCCCGCCGGGCTGCGGGAGG - Intergenic
1111672785 13:91349064-91349086 CGTAGCCGCCAGGGGGCGGCGGG - Intergenic
1112183763 13:97109469-97109491 CACCGCCGGGGGTGGGCGGGGGG + Intergenic
1112216319 13:97434314-97434336 CGCCGCCGCCGGCGCCCAGGGGG + Exonic
1112344361 13:98577315-98577337 CGCCCCCGCGGGCGGGCGGCGGG + Intronic
1112504543 13:99968335-99968357 CGCGGCCGCCGGGAGGGGGCAGG + Intronic
1112652703 13:101416284-101416306 CACCGCCGCCGGTGCCCGGGAGG - Intronic
1113473157 13:110561285-110561307 CGCCGGGGACGGGGGGCGCGGGG - Intronic
1113517417 13:110914518-110914540 CGGGGCAGCCGGGGGGCGCGGGG - Intronic
1113656974 13:112073257-112073279 CCCCGCAGCCTCGGGGCGGGAGG + Intergenic
1113657007 13:112073337-112073359 AGCCGCCGGCGGGGGGCGGGTGG + Intergenic
1113914783 13:113863789-113863811 CCCCGTCCCCGGGCGGCGGGAGG - Intronic
1116905085 14:50396631-50396653 CGCCTCCGCGGGGAGCCGGGAGG - Intronic
1117424463 14:55580385-55580407 CGCCGGCGGCGGGGAGCGCGGGG + Intronic
1118854700 14:69611838-69611860 CACCGCGGCCCGGGGGCGGCGGG + Intronic
1119330075 14:73787057-73787079 CGCCGGCGCCCGGTGGCGGGAGG + Intronic
1119420664 14:74506047-74506069 TGCCGCCCACGGGGGGCTGGAGG - Exonic
1120834415 14:89027287-89027309 CAGCCCCGCCGGGGGGCGGGGGG + Intergenic
1120914796 14:89701676-89701698 CGCCGGCGCCGGGAAGCGGGGGG - Intergenic
1121342860 14:93115605-93115627 TGCCGCCGCCTGAGGGCGTGTGG - Intronic
1121377791 14:93430409-93430431 CGCCGGGGCCGGAGGGCGCGAGG - Intronic
1121690839 14:95876366-95876388 CAGCGGCGCCGCGGGGCGGGGGG + Intergenic
1122183413 14:99971743-99971765 GGCCGCCGCCGGGGGATGGGGGG - Intronic
1122231197 14:100306972-100306994 CGCCGCCGCGGGCGCGCAGGCGG - Intergenic
1122399144 14:101457395-101457417 AGCTGCCGCCGTGGGGCGGGGGG + Intergenic
1122543371 14:102509713-102509735 CGTCGCCGGCGGCGGGCGGCGGG + Exonic
1122543372 14:102509716-102509738 CGCCGGCGGCGGGCGGCGGGCGG + Exonic
1122544975 14:102517157-102517179 CGCCGAGGCCGCGGGGCGAGGGG - Intergenic
1122912313 14:104836851-104836873 CGCCGGTGCAGGGGGGGGGGGGG - Intergenic
1122999834 14:105287413-105287435 GGCCGACGCTGCGGGGCGGGGGG - Intronic
1123396572 15:19943770-19943792 CGCGGCCGCGGGGGGGTTGGGGG - Intergenic
1123630742 15:22258203-22258225 CGCGGGCGCCGCGGGCCGGGCGG - Intergenic
1123717016 15:23040526-23040548 CGGAGGTGCCGGGGGGCGGGGGG + Intergenic
1123717973 15:23043724-23043746 CGGAGGTGCCGGGGGGCGGGGGG + Intergenic
1124427046 15:29570946-29570968 CGGCGCGGCCGGCGGGCGGGCGG - Intergenic
1124922278 15:34038805-34038827 GGCAGCCGCCGGGAGCCGGGAGG - Exonic
1125485572 15:40108739-40108761 GGTGGCCGCCGGGGGCCGGGCGG - Intronic
1125594236 15:40874069-40874091 CGCCGCCGCGGGGGAGGGGTCGG + Exonic
1125674221 15:41493956-41493978 TGGCGCGGCCGGGGGGCGCGAGG + Exonic
1126034924 15:44537036-44537058 CGCCGCCGCCTGAGGGGGCGTGG + Exonic
1127084085 15:55408451-55408473 GGCCGCCGCCGGGCGGCTGCGGG + Intronic
1128322029 15:66701161-66701183 CGCCGCGCCCGGGGGGGGAGGGG + Intergenic
1128489866 15:68134931-68134953 CGCCCCGTCCGGGGGGTGGGGGG - Intronic
1128490103 15:68135455-68135477 CGCCCCGTCCGGGGGGTGGGGGG - Intronic
1128865940 15:71115369-71115391 GGTCGCCGCCAGGGGGCGGCAGG + Exonic
1129189250 15:73927799-73927821 CGCCCCCGCCGGGTGGGGAGCGG + Exonic
1129199871 15:73992325-73992347 CGCCGCCGCGGGTGGCCGCGCGG - Exonic
1129424659 15:75454792-75454814 CGCCGCCGCCTTGGGGTGGGCGG + Intronic
1129503249 15:76059915-76059937 CGGGGCCGCGAGGGGGCGGGGGG + Exonic
1129644737 15:77419832-77419854 CGCCGCCGCCGGGGCTCTGGCGG - Intronic
1129761475 15:78131428-78131450 CGCCGCCGGCGGGAAGAGGGCGG + Exonic
1130115246 15:81000752-81000774 CGCTGCCGGCGTGGGGCCGGTGG - Intergenic
1130531062 15:84748366-84748388 CGCCTCGGGCGGGAGGCGGGAGG + Intergenic
1130656509 15:85795052-85795074 CGCCGGCACCGGGGGGTGGGGGG + Intergenic
1131272668 15:90956693-90956715 CGCCGCAGCCAGGCGGCGGCCGG + Exonic
1131827006 15:96330389-96330411 CGCCGCCGCCGAGAGGGGGATGG - Intronic
1132099802 15:99015195-99015217 CGCCGAGGCCGGGGCGCGCGTGG - Intergenic
1132560197 16:590047-590069 CGGCGCGGCCGGGGGTGGGGCGG + Intronic
1132575421 16:661657-661679 CACCGGCTCCGGGAGGCGGGTGG - Exonic
1132683548 16:1153288-1153310 AGCCGCGGCCGGGAGCCGGGCGG + Exonic
1132683807 16:1154045-1154067 CCCGGCCGGCGGGGGGCGGGGGG + Intronic
1132741269 16:1414507-1414529 CGCGGAGGCCGGGGGGCGCGGGG + Intronic
1132805039 16:1771456-1771478 CGGCGCGGGCCGGGGGCGGGTGG - Intronic
1132828896 16:1918141-1918163 GGCCGGCGCGGGGGCGCGGGCGG + Exonic
1132947142 16:2537968-2537990 CGCCGGGGGCGGGGGGCGGCGGG + Exonic
1133040925 16:3059398-3059420 GGCTGCCGCCAGGGGGCGGTCGG + Exonic
1133097582 16:3458002-3458024 CGCTGCCGGCAGGGAGCGGGAGG + Intronic
1133156446 16:3880127-3880149 CGGCGGCGGCCGGGGGCGGGCGG - Exonic
1133156588 16:3880512-3880534 CGCCGCCGCCGGGCTCCGGGAGG + Exonic
1133156769 16:3881096-3881118 CGCCGCCCCAGCGGGACGGGCGG - Intergenic
1133259428 16:4538564-4538586 CGCCGCGGGCGGGGGCGGGGAGG + Intronic
1135821728 16:25691913-25691935 CGGCGCCGCCGAGGGAAGGGGGG - Intergenic
1136367663 16:29816369-29816391 CGCCCCCTCCCGGGGACGGGCGG + Exonic
1136768596 16:32812008-32812030 CGCGGCGGCGGGGGGGGGGGGGG + Intergenic
1137261121 16:46830956-46830978 CGCCGCCGCCGGCGGGCCCCAGG + Intronic
1137714817 16:50592229-50592251 TGCCGCCGCCTGGGGGCTGCTGG + Intronic
1137988468 16:53130470-53130492 CGGCGGGGCCGCGGGGCGGGCGG + Intronic
1139364833 16:66427048-66427070 CGCCGCCGCCGAGGGGGGCCGGG + Intergenic
1139433861 16:66925311-66925333 CGCCGCGACCTGGGGGCTGGGGG - Intronic
1139459429 16:67110036-67110058 CGCTGCCGCCGGGGAGGAGGTGG + Exonic
1139489639 16:67279446-67279468 CGCCGCCCCCTGGAGGCCGGAGG - Exonic
1139890657 16:70251549-70251571 CGCAGCCGCCCGGGGGAGCGCGG + Exonic
1139974794 16:70800979-70801001 CGCCGGCGCCGGGGGCAGAGCGG - Exonic
1141054526 16:80803713-80803735 CGCCGCGGCCGGCGGGGGTGTGG - Intronic
1141054837 16:80804749-80804771 CGGGGCCCCCGGGGGGCGGCGGG + Intergenic
1141582722 16:85011321-85011343 CGCCGCCGCCGCAGGCCGGGAGG - Exonic
1141608608 16:85169325-85169347 CGCCGCCGCCGGGGGGTGCTCGG + Intergenic
1141959156 16:87392720-87392742 GGCAGCCGGCGGAGGGCGGGCGG + Intronic
1141972303 16:87492370-87492392 CGCGGGCGCCGCGGGCCGGGCGG + Intergenic
1142037255 16:87869731-87869753 CGCGGGCGCCGGGAGGGGGGAGG - Intergenic
1142240183 16:88941389-88941411 CGGCGGCGGCGGGGGGCAGGAGG - Intronic
1142350298 16:89576442-89576464 GCCGGCCGACGGGGGGCGGGAGG + Intronic
1142465329 17:133948-133970 CGCGTCCCCTGGGGGGCGGGGGG + Intergenic
1142468339 17:148312-148334 GGCCTCCGCCGGGGGCCAGGAGG + Intronic
1142549938 17:732404-732426 CGGCGTCCCCGGCGGGCGGGTGG - Exonic
1142610825 17:1108634-1108656 CGCCGCCTCCCTGGAGCGGGTGG - Intronic
1142762355 17:2050046-2050068 CAGGGCCGCGGGGGGGCGGGCGG + Intergenic
1142764670 17:2058490-2058512 CGGCGCGGCCGGGGCGCTGGCGG + Exonic
1142840660 17:2626558-2626580 CTCCGCCTCGGGGGGGGGGGGGG - Intronic
1142876289 17:2853639-2853661 GGCCGAGGCCGGGGCGCGGGAGG + Intronic
1142983628 17:3685464-3685486 TGCGGCCGCCGGGGAGAGGGTGG + Intronic
1143078873 17:4366722-4366744 TTCCGCCGCCGGGGGCGGGGCGG - Intergenic
1143321174 17:6070288-6070310 CCCCTCCCCCGGGCGGCGGGAGG + Intronic
1143350999 17:6288273-6288295 ACCAGCTGCCGGGGGGCGGGTGG - Intergenic
1143446873 17:7014954-7014976 CGCCCCGGGCGGGGGGCGGGCGG + Intronic
1143483429 17:7239550-7239572 CGGCGCCGGCGGGGGGAGGAGGG - Intronic
1143485386 17:7251344-7251366 GGCTGCCCCCGGGGGGCTGGCGG - Exonic
1143527265 17:7479699-7479721 CGCCGCCGCCGAGAGGAGGCCGG + Intronic
1143590666 17:7884686-7884708 CGCCGCCGCCGAGGAGGAGGAGG + Intronic
1144021307 17:11241539-11241561 CGCTGCCGTCGGGGGCCGGAGGG + Exonic
1144784430 17:17823818-17823840 CCCCGCCGCCGTGGGGAGGTGGG - Intronic
1145765517 17:27456269-27456291 CGCGGCCGCCGGGAGGGGAGGGG + Intergenic
1145922644 17:28622082-28622104 CGCAGCCTGAGGGGGGCGGGGGG + Intronic
1146034091 17:29390829-29390851 CGGCGGCGGCGGGGGGTGGGGGG - Exonic
1146370966 17:32265677-32265699 CGGCGCGGCCCGGGAGCGGGAGG - Intergenic
1147132877 17:38419340-38419362 CGCCGGCCCCGGGGGGCGCAGGG - Intergenic
1147139591 17:38453789-38453811 CCGCGGCTCCGGGGGGCGGGCGG + Intronic
1147307408 17:39573641-39573663 CGCCGCCGCCGGGCCGCGCCGGG + Intergenic
1147971297 17:44220070-44220092 TGCCGCCGCCGGGGAAGGGGGGG + Intronic
1147971521 17:44220923-44220945 CGCCGAGGCGGGCGGGCGGGCGG - Intronic
1147987578 17:44315332-44315354 CGGCGGGCCCGGGGGGCGGGCGG + Intronic
1148060134 17:44830327-44830349 CGCCGCGGCCCGGGAGCGGGGGG + Intronic
1148178019 17:45584693-45584715 CGCCCCGGCCGGGGGGAGGCGGG - Intergenic
1148299507 17:46534786-46534808 CGCCCCCTCCGGGAGGTGGGGGG - Intronic
1148323719 17:46771751-46771773 CGGCGCGGCGCGGGGGCGGGGGG - Intronic
1148440416 17:47709022-47709044 CGCCGCCCCCGCCGGGCGAGAGG + Exonic
1148633949 17:49132914-49132936 CGCCGGAGCCAGGGAGCGGGCGG + Intronic
1148798124 17:50207147-50207169 GGGCGTGGCCGGGGGGCGGGTGG + Intergenic
1148852515 17:50561751-50561773 CCGCACCGCCGGGGGTCGGGGGG + Intronic
1149296281 17:55265041-55265063 GGCCGCCGGCGCGGGGAGGGGGG + Exonic
1149296283 17:55265044-55265066 CGCCGGCGCGGGGAGGGGGGTGG + Exonic
1150407907 17:64918979-64919001 CGCCCCGGCCGGGGGGAGGCGGG - Intronic
1151491040 17:74432451-74432473 AGCCCCAGGCGGGGGGCGGGCGG - Intronic
1151537948 17:74749215-74749237 GGCCGCCGCCGAGGTGCAGGGGG + Exonic
1151866422 17:76806241-76806263 CGGCGGGGCCGGGGGGCTGGCGG - Intergenic
1152192475 17:78897097-78897119 GGAGGCCGGCGGGGGGCGGGGGG - Intronic
1152357350 17:79813547-79813569 GGCGGCCGGAGGGGGGCGGGCGG + Intergenic
1152663119 17:81552138-81552160 CGCCGGCCCGCGGGGGCGGGAGG - Intronic
1152744184 17:82031594-82031616 CGCGGCCGGCGGGGGGCGGGGGG - Intergenic
1152744882 17:82034029-82034051 GGCCCCCGCCGGAGGCCGGGAGG + Exonic
1152924402 17:83080570-83080592 CGCCACCGCGGGTGGGGGGGGGG - Intronic
1152947384 17:83205446-83205468 GGCCGCCGCGGTGGGGTGGGCGG + Intergenic
1153060584 18:990861-990883 TGCTGCTGCTGGGGGGCGGGTGG + Intergenic
1153382600 18:4455375-4455397 CACCGGAGCCGGCGGGCGGGCGG + Intergenic
1153794468 18:8609668-8609690 GCGCGCAGCCGGGGGGCGGGCGG + Exonic
1154125545 18:11689453-11689475 CGCCTCAGCGGAGGGGCGGGAGG - Exonic
1155053819 18:22169038-22169060 CGCCGCCGCCGCGGCGGGAGGGG - Intergenic
1155392093 18:25349588-25349610 CACAGCGGCCGGGGGCCGGGAGG + Intronic
1156008444 18:32470477-32470499 GGCGGCCGCCGAGGCGCGGGTGG - Intronic
1156275792 18:35581712-35581734 CGGCTCCCCCGGCGGGCGGGCGG - Intronic
1156411163 18:36829158-36829180 CGCCGCGGCACTGGGGCGGGAGG - Exonic
1156495852 18:37524804-37524826 AGCCGCGGCCGGGGCGCGGAGGG - Intronic
1156698828 18:39799351-39799373 GGGCGGCGGCGGGGGGCGGGGGG + Intergenic
1157324101 18:46656872-46656894 CCCAGCCTGCGGGGGGCGGGTGG - Intronic
1157386589 18:47263501-47263523 CTCCGCCTCCGGAAGGCGGGCGG + Intergenic
1157794102 18:50559622-50559644 TGCAGCCGCCGGGGGCCCGGTGG - Intergenic
1159798488 18:72869164-72869186 CGGGGTCGCCGGGGGGCGGGGGG + Intergenic
1160024929 18:75209227-75209249 CGCCGGCGCCGGGGAGGCGGGGG - Exonic
1160668526 19:344725-344747 CGCGGACGCGCGGGGGCGGGGGG + Intronic
1160685927 19:436576-436598 CGCGGCCGGAGGGGGGCGGCAGG + Intronic
1160768875 19:821650-821672 CGGCGCCGGCGGGGGAGGGGCGG + Intronic
1160791549 19:925882-925904 CGCCGCGGCCCGGGCGCGGGAGG - Intronic
1160847751 19:1173906-1173928 GGGGGTCGCCGGGGGGCGGGGGG + Intronic
1160865519 19:1254301-1254323 CGCCGCCGCTGCTGCGCGGGGGG + Exonic
1160873166 19:1286076-1286098 CGCCGCCGCCGCCGAGCGGGCGG - Intergenic
1160960609 19:1719051-1719073 CGCCGCCGCAGCGGGGCTGGGGG + Intergenic
1160967627 19:1753570-1753592 CGCAGCCACCGGGGAGCGGGCGG + Exonic
1161238169 19:3208137-3208159 CGCCACCATCGGGGAGCGGGAGG - Exonic
1161241152 19:3224692-3224714 CGGCGGCGGCGGGCGGCGGGCGG - Exonic
1161256813 19:3314285-3314307 CGCTCCTTCCGGGGGGCGGGAGG + Intergenic
1161266357 19:3366518-3366540 CGCGCCGGCCGCGGGGCGGGGGG + Intronic
1161378791 19:3953628-3953650 AGCAGCTGCAGGGGGGCGGGGGG + Intergenic
1161400650 19:4065349-4065371 CGCTGCGGCCGGGGCGGGGGAGG - Intronic
1161628768 19:5340886-5340908 CGCCGCCGCCGCCGGGTCGGGGG + Intergenic
1162363943 19:10236552-10236574 CCCCGGTGGCGGGGGGCGGGGGG + Intergenic
1162683300 19:12362615-12362637 CGCCCCCTCCGGGAGGTGGGGGG + Intronic
1162754260 19:12847752-12847774 CGAGGCCGCCAGGGGGCGCGCGG - Intronic
1162803225 19:13122514-13122536 TGCCCCTGCCGGGGGGGGGGGGG + Intronic
1163121933 19:15223529-15223551 CGCGGCCGCCGGCGGGAGGGAGG - Intergenic
1163334332 19:16661138-16661160 CGCAGTCGCCGGGCCGCGGGCGG + Exonic
1163606973 19:18280974-18280996 CGCCGCCGCCGGGGGGCCCTCGG - Exonic
1163807057 19:19405834-19405856 CGGCGGCGCGGGCGGGCGGGCGG + Intronic
1165157278 19:33796261-33796283 GCCGGCCGGCGGGGGGCGGGGGG + Intronic
1165204529 19:34172469-34172491 CGCCGCGGCTTGAGGGCGGGAGG + Intergenic
1165448239 19:35868518-35868540 CGGCGCAGCCCGGGGGCGGCGGG + Exonic
1165861665 19:38912256-38912278 CGCCGCGGGCGGGGAGGGGGCGG - Intergenic
1165924957 19:39320964-39320986 CGCCGCCGCAAGGGGGGAGGGGG + Intergenic
1166106692 19:40601246-40601268 CGCGGCCGCCGGGGAGGGAGTGG + Intronic
1166106716 19:40601304-40601326 CTCCCCCGCGGGCGGGCGGGCGG + Intronic
1166520261 19:43475351-43475373 CTCCGCCGGCGCGGGGCGCGGGG - Exonic
1166749667 19:45158896-45158918 CGCTGCCGCAGGGGGCTGGGAGG + Exonic
1167428474 19:49441560-49441582 CGCCGGGGGCGGGGCGCGGGAGG + Intronic
1167557171 19:50203686-50203708 CGCCGCCCCCGGAGGGCTGCCGG - Intronic
1167577140 19:50323176-50323198 CCCCGCTGCCGTGGTGCGGGTGG + Exonic
1168239449 19:55081878-55081900 AGCCGGCGCCGGGCGGCTGGGGG + Exonic
1168272632 19:55258483-55258505 CGCCGGCGGCGGGGCGGGGGGGG - Exonic
925394462 2:3522813-3522835 TGCCGCAGCCTGGGGGTGGGAGG - Intergenic
925927643 2:8681797-8681819 CGGGGCTGGCGGGGGGCGGGGGG - Intronic
925929088 2:8693452-8693474 AGCCGCAGCGGGGCGGCGGGAGG + Intergenic
925984645 2:9206440-9206462 CGCCGTGGGCGGGGGGCGGTTGG + Intergenic
926217094 2:10912348-10912370 CGCTGCCGCTGGGGGTCCGGCGG - Exonic
927881503 2:26692837-26692859 CGGGGGCGCCGGGGGGCCGGCGG + Exonic
927904286 2:26846531-26846553 CCCCGCCGCCGGGAGGCCGCTGG + Intergenic
928149270 2:28811204-28811226 CTACGCCGCCGGGCGGAGGGCGG - Intronic
929151224 2:38750908-38750930 AGCCGCCGCCGAGGGCGGGGGGG + Intronic
929857621 2:45650304-45650326 CGCGCCCTCCGGGGGGCGAGTGG - Intergenic
930700739 2:54456458-54456480 CCCGGCCGCCGAGGAGCGGGAGG + Exonic
931052315 2:58428520-58428542 CGGGGCCGCCGGGGGCGGGGAGG - Intergenic
931253762 2:60553820-60553842 CGCGGCCCCCGGGGGAGGGGCGG + Intergenic
931614643 2:64144020-64144042 CGGGGCCGCCGAGGGGCGCGGGG - Intronic
931694254 2:64859960-64859982 GGCCGCAGCCCCGGGGCGGGAGG + Intergenic
931710998 2:64989163-64989185 CGAGGCCGCGGGGGCGCGGGCGG - Intronic
932567690 2:72919985-72920007 CGCCGCGGCCGAGGGGCTGGCGG + Intronic
932595153 2:73088842-73088864 GGCCGCCGCCCTGGGGAGGGGGG - Intronic
932699992 2:73985454-73985476 CCGCGCCGCCGAGGGGCGCGGGG - Intergenic
933666816 2:84971141-84971163 CGCCGCTGCCGGGAGCCGGCAGG + Exonic
933886079 2:86720287-86720309 CGCCGCCGACTGGGGGGAGGGGG - Exonic
934966825 2:98731004-98731026 CGGCGGCGCGCGGGGGCGGGAGG - Intronic
935250137 2:101253426-101253448 CGCCGCGGGCGGGCGGCGCGGGG - Exonic
935292565 2:101622533-101622555 GGTCGCCGGCGGGGGGCGGTGGG - Intergenic
935622817 2:105144075-105144097 CGCAGCTGCCGGGGGCCGGGAGG - Intergenic
935731064 2:106065460-106065482 CGCCGGCGGCGGGGGCCGCGTGG - Intronic
935746507 2:106194081-106194103 CGGCGCCGCGGTGGGCCGGGCGG - Intronic
936278563 2:111120175-111120197 CGCCGCCTCCCGGGTGAGGGCGG - Intronic
936390775 2:112071300-112071322 GGCGGCGGCGGGGGGGCGGGGGG - Intronic
936396953 2:112138531-112138553 CCGCGCGGCCGGGGGGCGGCTGG - Exonic
937284566 2:120741845-120741867 CGCCGCCGGCGAGTGGCGGGAGG + Intronic
938418426 2:131123781-131123803 GGCCGAGGGCGGGGGGCGGGGGG - Intronic
938828880 2:135033458-135033480 CGCCCCGTCCGGGGGGTGGGGGG - Intronic
939432654 2:142130777-142130799 CGCCGCCGCCGCCGGGCCGAAGG - Exonic
940883303 2:158968484-158968506 CGCCGCAGCCCGGGGCGGGGAGG + Intergenic
941020965 2:160407653-160407675 GGCCGCCGCCGCGCGGCGAGAGG - Intronic
941021047 2:160407978-160408000 CGCCGCGCCCAGCGGGCGGGCGG - Intronic
941773235 2:169364520-169364542 AGCGGCCGCCGGCTGGCGGGAGG + Intergenic
942046557 2:172102439-172102461 CGCCGCCGCTCGGGGGCTGCTGG + Exonic
942241107 2:173964673-173964695 CGCCGCCGCCGGGGGGCGGGTGG - Intronic
942241109 2:173964676-173964698 CGCCGCCGCCGCCGGGGGGCGGG - Intronic
942278096 2:174336949-174336971 TGCCGCCGCCGGGGGGAGCTCGG + Exonic
942453542 2:176123016-176123038 CGCCGCTGCCGGGGGCTGGGAGG - Exonic
943669792 2:190648857-190648879 GGCCGCCGCCGGGCGGGGGCGGG - Intronic
944496082 2:200307558-200307580 CGCCGCCGCATTTGGGCGGGGGG + Intronic
945225877 2:207530484-207530506 CGCCGCCGCCGGGCCGGGCGCGG + Intronic
945891597 2:215436188-215436210 TGCGGCGGCCGGCGGGCGGGCGG - Intergenic
946161029 2:217836157-217836179 CGCCTCCGCAGAGGGGCTGGGGG + Exonic
946340030 2:219060754-219060776 CGGCGGCGGCGGGGGGCGGCGGG + Intergenic
946921315 2:224584812-224584834 CCCCGCGGCCGGCGGGCGTGGGG + Intronic
947418566 2:229921951-229921973 CGCCGCCGCCGCGCCGCTGGGGG - Exonic
947632290 2:231662110-231662132 CGCAGGCGCCGGTGCGCGGGTGG - Intergenic
948116039 2:235494642-235494664 CGGCGGCGGCGGGGGGCGCGCGG + Exonic
948854753 2:240724925-240724947 CACCGGCGGCGGGGGGGGGGGGG + Intronic
948953793 2:241272309-241272331 CGCCCCCGCCGGAGCGGGGGAGG + Intronic
948958605 2:241315147-241315169 CGCCGCCCCGCGGGGGAGGGCGG - Intronic
1168765828 20:381200-381222 CCCGGAGGCCGGGGGGCGGGAGG + Intronic
1169065685 20:2693167-2693189 TGGCGCCGCGGGCGGGCGGGCGG + Intronic
1169214624 20:3786022-3786044 AGGCGCCGCCGGGGTGCGGGGGG + Exonic
1169214736 20:3786519-3786541 CGCCGCCGCCCCGGGGCGGGGGG + Exonic
1170999290 20:21396888-21396910 CGCCACAGCCGAGGGGCGCGGGG - Intronic
1171123705 20:22584891-22584913 CGCCGCGGCGGTGGGGCGGACGG - Intronic
1171810134 20:29740893-29740915 CCCGGCAGGCGGGGGGCGGGCGG + Intergenic
1172284643 20:33732137-33732159 CGCAGCGGCCGCGGGGCGGAGGG + Intronic
1172951100 20:38724072-38724094 CGCCGCCGCAGGGTGGGAGGGGG - Intergenic
1174246812 20:49188049-49188071 CGCCGCCGCGGTGGGGAGGTGGG - Intronic
1174467891 20:50731526-50731548 CGTCGCCGCCGGGGCCCGGAGGG + Exonic
1174494707 20:50931241-50931263 GGCGGCGGCCGGGGGGGGGGGGG + Intergenic
1175210485 20:57350926-57350948 GGGCGGCGCGGGGGGGCGGGGGG + Intergenic
1175521239 20:59604060-59604082 CCTCCCTGCCGGGGGGCGGGGGG - Intronic
1175847283 20:62065508-62065530 GAGCGCGGCCGGGGGGCGGGGGG - Exonic
1175944346 20:62551702-62551724 CGCTGATGCCGGGGGCCGGGCGG + Intronic
1176005796 20:62861706-62861728 CGCGGGCGGCGGGCGGCGGGAGG + Exonic
1176015029 20:62926521-62926543 CGGCGCCCCCGCGCGGCGGGCGG + Intronic
1176131759 20:63499295-63499317 CGCCGCGGGCGGGGGCGGGGCGG + Exonic
1176178682 20:63739921-63739943 GGCCGGCGGCGCGGGGCGGGGGG - Exonic
1176221072 20:63969657-63969679 CGGCGCCGGCGCGGGGCGCGGGG + Intronic
1176283409 20:64328086-64328108 CGGCGCCGGCGGGGGGAGGGAGG - Intergenic
1176547367 21:8207687-8207709 CGCGGCGGCCGGCGGGCGGTGGG + Intergenic
1176555272 21:8251896-8251918 CGCGGCGGCCGGCGGGCGGTGGG + Intergenic
1176566318 21:8390734-8390756 CGCGGCGGCCGGCGGGCGGTGGG + Intergenic
1176574192 21:8434921-8434943 CGCGGCGGCCGGCGGGCGGTGGG + Intergenic
1176586877 21:8595709-8595731 CGCGGCAGCGGGGGGGGGGGGGG - Intergenic
1176619143 21:9043121-9043143 CGCAGGCGCCGGGGGGTGGGGGG - Intergenic
1177779525 21:25607592-25607614 CGCCTCCACCGGGGGGCGTCAGG + Intergenic
1178440426 21:32593874-32593896 CCCCGGCGGCGGGGGGCGGTGGG - Intronic
1178513826 21:33229893-33229915 CGCCGGCGCGGGGGCGGGGGCGG - Intronic
1178513828 21:33229896-33229918 CGCCGCCGGCGCGGGGGCGGGGG - Intronic
1178513832 21:33229899-33229921 CGCCGCCGCCGGCGCGGGGGCGG - Intronic
1178992450 21:37367039-37367061 TGCCGCCGCCGGCGAGCAGGCGG + Intronic
1179375461 21:40846769-40846791 CGGCGGCGGCGGGCGGCGGGCGG - Exonic
1179605625 21:42513753-42513775 CGCGGCGGCCGGGGAGGGGGAGG + Intronic
1179891808 21:44339078-44339100 CGCGGCCGCCCCGGGGTGGGGGG - Intronic
1179968179 21:44818551-44818573 CGCGGCGGCAGGGAGGCGGGTGG - Intronic
1180068230 21:45423495-45423517 CGGGCCCTCCGGGGGGCGGGGGG - Intronic
1180733897 22:18001501-18001523 CGGCGCAGCCGGGGGATGGGCGG + Intronic
1180908362 22:19431568-19431590 GGCGGCGGCCGGAGGGCGGGTGG - Exonic
1180949441 22:19714563-19714585 GGCCGCCGGCGGGGGACGTGCGG - Exonic
1181270823 22:21657628-21657650 CGCCGCGGCCGTGGGGAGAGAGG + Intronic
1182123507 22:27801080-27801102 CGGGGACTCCGGGGGGCGGGGGG - Exonic
1182586281 22:31345948-31345970 CGCCGGCGCCGCCTGGCGGGCGG - Exonic
1183093760 22:35540497-35540519 CGCTGGCGCTGGGCGGCGGGAGG + Intergenic
1183683765 22:39350200-39350222 CGCCGCCGCCGGGGGCCCGTTGG - Intronic
1183720324 22:39558395-39558417 CGCAGCCGCGGAGGGGCGGCCGG - Intergenic
1183856188 22:40636589-40636611 CGCCGCCAGCGGAGGGCGTGTGG + Exonic
1184146501 22:42614611-42614633 CGCCTCGGCCAGTGGGCGGGCGG + Intronic
1184337544 22:43862567-43862589 CGCCGCGGCCGCGTGCCGGGCGG - Intergenic
1184676264 22:46045020-46045042 CGCCGCCGGGCGAGGGCGGGAGG - Intergenic
1184796872 22:46737976-46737998 CGCCGCCGCCCGGGTTCGGCCGG - Intronic
1185055238 22:48575792-48575814 CGCCGCCGCCGGGGTCCGCGCGG - Intronic
1185296717 22:50058315-50058337 CGCGGGCGGCGGGGGGCGCGGGG + Intergenic
1185333444 22:50261624-50261646 CCCAGCGGCCGGCGGGCGGGCGG - Exonic
1185333524 22:50261815-50261837 GGCCGCCGCCGGGGGAGGGCCGG + Exonic
1185374143 22:50474557-50474579 GGCCGGGGCCGGGGGCCGGGCGG - Intronic
1185409383 22:50674294-50674316 CGCCGGAGGCGGGGGCCGGGAGG - Intergenic
1203252240 22_KI270733v1_random:123972-123994 CGCGGCGGCCGGCGGGCGGTGGG + Intergenic
1203260295 22_KI270733v1_random:169058-169080 CGCGGCGGCCGGCGGGCGGTGGG + Intergenic
949970250 3:9397681-9397703 CGCCGCTGCCGGGGGAGGGGCGG + Intronic
951543625 3:23806110-23806132 CGGCGCGGCCGGGGGGCGGCGGG - Intronic
952816667 3:37452698-37452720 CTCGGCCGCCGGGGGACGGCGGG + Intronic
953404651 3:42654463-42654485 CGCGGCGGGCGGGGGGCGCGGGG - Intronic
953440147 3:42909695-42909717 CGCCCCCTCCGGGAGGTGGGGGG - Intronic
953618221 3:44510723-44510745 CGCTGGCGGCGGGCGGCGGGCGG + Intergenic
953909175 3:46883183-46883205 CGGCGCGGGAGGGGGGCGGGGGG + Intronic
953947578 3:47163360-47163382 CGCCGCCGTCGCGGGGAGGTCGG + Intronic
954110105 3:48429002-48429024 CGTCGCCGCCGGGGACCGGCCGG - Intronic
954468872 3:50674952-50674974 CGGCGGCGCCGGGAGCCGGGCGG + Intergenic
954717327 3:52533299-52533321 CCCCGACGCCCGGGGGCGGGCGG - Intronic
954764003 3:52897666-52897688 CCCCGCCCCTCGGGGGCGGGTGG - Intergenic
954779069 3:53046016-53046038 CGCCTCCGCCGGAGCGCGGGTGG - Exonic
955368736 3:58332951-58332973 CGCCGCCGCCTAGGGACGCGAGG - Exonic
957028641 3:75214601-75214623 CGTCGCCGCCGGGGGGAGGAGGG + Intergenic
959530736 3:107431544-107431566 CGCCGCCGCCGGGGCTCGGGCGG + Intergenic
959539458 3:107523393-107523415 GGCTGGGGCCGGGGGGCGGGGGG + Intronic
959849720 3:111071968-111071990 CGGGGGAGCCGGGGGGCGGGCGG + Exonic
960896747 3:122514376-122514398 CGCCGCGGCCGGGCGGCGGGCGG - Intronic
961450281 3:126999498-126999520 CCCAGCCGCCGGGAGGCAGGGGG - Intronic
962520744 3:136195850-136195872 GGCCGCCGCCGGCGGGCGGGAGG + Intronic
962520748 3:136195853-136195875 CGCCGCCGGCGGGCGGGAGGGGG + Intronic
963236722 3:142963611-142963633 CGCCGCTGCCGCAGCGCGGGCGG - Exonic
963244697 3:143047634-143047656 CGCCCCGTCCGGGAGGCGGGAGG - Intronic
966762039 3:183427693-183427715 CGCCGCTGGTGGGGGTCGGGGGG - Intronic
967858255 3:194134272-194134294 CGCCGCCGCCGGGTGCCACGTGG - Intergenic
967904101 3:194486792-194486814 CGCCGCCGCCGCGGGCGCGGAGG - Intronic
967904140 3:194486919-194486941 CGCCGCCGCGGAGGGGAGGGGGG - Intronic
968093049 3:195909777-195909799 CGCCGCCCCGGGGTGGGGGGTGG + Intronic
968582964 4:1403469-1403491 CAGCGGCGCCGGGGGGCGCGGGG - Exonic
968636644 4:1684368-1684390 CGGCGGCGGCGGGGCGCGGGCGG - Intergenic
968667368 4:1828771-1828793 CGCCCCGTCCGGGGGGTGGGGGG - Intronic
968674720 4:1871355-1871377 CGGCGGCGGCGGCGGGCGGGAGG + Intergenic
968701305 4:2059409-2059431 CGCCGCCGCCGCGGGTCCGAGGG + Intergenic
968727690 4:2255890-2255912 TGCCGCTGCCGGGGAGCTGGGGG + Intronic
968729229 4:2261872-2261894 CGCCCGCGGCGGTGGGCGGGCGG - Intronic
968729262 4:2261995-2262017 CGCCGCCGTCCCGGGGCGGACGG - Exonic
969113362 4:4857066-4857088 CGCCGCGGGGGGGGGGGGGGGGG - Intergenic
969113366 4:4857069-4857091 CTCCGCCGCGGGGGGGGGGGGGG - Intergenic
969357847 4:6641120-6641142 CGACGCGGCCGAGGGCCGGGCGG + Exonic
969362614 4:6674275-6674297 CGCGGCCGGCGCGGGGCGCGGGG - Intergenic
970333003 4:15003711-15003733 CGCCGCCGCCCGGGTGTGGAAGG - Exonic
971282026 4:25249443-25249465 CGCCCCATCCGGGAGGCGGGGGG - Intronic
971322931 4:25619990-25620012 AGCCGGGGCAGGGGGGCGGGGGG + Intergenic
972396518 4:38663730-38663752 CGCCGCCGCCCGAGCCCGGGGGG - Intergenic
972418752 4:38867742-38867764 GGACGCGGCCGGAGGGCGGGCGG - Intronic
972671457 4:41216411-41216433 CGCGGCGGCGGGGGGGGGGGGGG + Intronic
972793997 4:42398363-42398385 AGCCGCCGCCGTTAGGCGGGCGG - Intronic
974047292 4:56908407-56908429 AGCAGCCGCCCGGGGGCTGGGGG + Intronic
974716016 4:65669688-65669710 CGCCGCCGCTTGGGGGCCGCCGG + Exonic
976226588 4:82799022-82799044 CGCCTCCGCCCGGGGGCGGGTGG + Intergenic
976600709 4:86935280-86935302 CGGCGGCGTCGGGGGCCGGGCGG - Intronic
978361127 4:107931875-107931897 CTCCGCCGCCGGAGGAAGGGAGG - Exonic
978954590 4:114598694-114598716 GGGCGCGGCTGGGGGGCGGGGGG + Exonic
979547163 4:121951556-121951578 CGCCGCCGCCGGGGCTGGAGGGG - Exonic
980541441 4:134201532-134201554 CGCCGCCGCCGAGGCGCTGCCGG + Intronic
981722475 4:147815463-147815485 GGCCGGAGGCGGGGGGCGGGGGG + Intronic
981782628 4:148444765-148444787 CGCCGCCGCTGGGGGCGGGCGGG - Intergenic
982712211 4:158768951-158768973 CGCCGCCGCCGTGGGGCTGCGGG + Intergenic
983398521 4:167234074-167234096 GGCTGCAGCCGGGGGGCGGTCGG - Exonic
983904361 4:173168971-173168993 TGCCGCCGGAGGGGGCCGGGCGG - Intronic
984888956 4:184474586-184474608 CGCGGCCGGAGGAGGGCGGGGGG - Intergenic
984973506 4:185210201-185210223 CGCCGCCGCCTGGAGCCGGCTGG + Intronic
985064062 4:186104741-186104763 CGCGGGCGGCGGGCGGCGGGCGG + Intronic
985727567 5:1524037-1524059 CGCCCCTGCCGGCCGGCGGGAGG - Intergenic
985936759 5:3103284-3103306 TGCAGCCGCCGGGGGACTGGAGG - Intergenic
985995681 5:3595843-3595865 CCCCGCCGCCGAGCGGAGGGCGG + Intergenic
987050470 5:14143766-14143788 GGCCGCCGCGGCGGGGCCGGAGG - Exonic
988547696 5:32173950-32173972 CGCCGCCGACAAGGAGCGGGCGG - Exonic
989229984 5:39074470-39074492 CGCCGCCGAGGGGGCGGGGGAGG - Intergenic
989229985 5:39074473-39074495 CGTCGCCGCCGAGGGGGCGGGGG - Intergenic
990955153 5:61332812-61332834 CGCCGCCGCCGCGGGGGCCGGGG + Exonic
991587353 5:68215083-68215105 CGCCGCCTCCGGGAGCCAGGCGG - Intergenic
991587474 5:68215532-68215554 CCCCGCGGCTGGGGGGCGGAAGG + Intergenic
992226219 5:74621672-74621694 GGCCGGGGGCGGGGGGCGGGGGG - Intergenic
995650408 5:114362360-114362382 CCCCGCCGCCGGGGCACCGGAGG - Exonic
996329429 5:122312304-122312326 GGACGCCGCGGGGAGGCGGGAGG + Intronic
996379048 5:122845526-122845548 CGCGGGCGCAGCGGGGCGGGAGG + Exonic
996379117 5:122845769-122845791 CGCCGCCGCCTTGGCGCAGGGGG + Intronic
997302143 5:132813896-132813918 CGCTGCCCCCGGGGGGCCGAAGG - Exonic
997521256 5:134525812-134525834 CGTCCCCGGCGGGGGGCGTGGGG + Intronic
997521280 5:134525891-134525913 GGCCGGCGCGGGAGGGCGGGGGG - Intronic
998203917 5:140145964-140145986 CGGCGCCGCCAGGGGGCGAATGG + Intergenic
998366575 5:141636514-141636536 CGCCTCGGCCGGGGGTTGGGGGG - Intronic
1002131917 5:177087112-177087134 CCCAGCCGCCAGGGGGCGAGAGG + Intronic
1002140287 5:177133732-177133754 CGCGGCCGCGGGGGCGCGCGCGG + Intronic
1002190163 5:177473667-177473689 GCCGGCCGGCGGGGGGCGGGGGG + Intronic
1002670346 5:180861357-180861379 CGACGGCGCCGGCGGGAGGGAGG + Intergenic
1002741264 5:181437132-181437154 GGCCGCCGCGGTGGGGTGGGCGG + Intergenic
1002897856 6:1389743-1389765 CGGCGGCGGCGGCGGGCGGGAGG - Intergenic
1004690194 6:17987197-17987219 CGGCGCGGCTGGCGGGCGGGCGG - Intronic
1005554187 6:26956631-26956653 GCCCGCGGCTGGGGGGCGGGGGG + Intergenic
1005825998 6:29632330-29632352 CTCCGCCCCCCGGGCGCGGGCGG - Exonic
1006083527 6:31580993-31581015 CCCCGCCGCCAGGGGGCGCCCGG + Exonic
1006137144 6:31902038-31902060 CGCCGCCGCCGCCGCGCGCGCGG - Intronic
1006472506 6:34236739-34236761 CGCCGCCGCTGCCGCGCGGGTGG - Intergenic
1006472654 6:34237327-34237349 CGCCGCCGCCGCGGGCCCCGGGG - Intronic
1006498262 6:34439855-34439877 CGCCGCTGCTGGGCGGGGGGGGG - Intergenic
1006617917 6:35342474-35342496 GGCCGCCGCCGGGCGGAAGGGGG + Intergenic
1006717678 6:36130711-36130733 CTGGGCCGCTGGGGGGCGGGGGG + Intronic
1007623496 6:43229162-43229184 CGCAGCTGCCGGGGGTCGGGGGG + Intronic
1007902267 6:45422974-45422996 CGCTCCCGGCCGGGGGCGGGGGG - Intronic
1008649063 6:53544939-53544961 CGCCGCCGCATCGGAGCGGGAGG - Exonic
1010141926 6:72622257-72622279 CGGCGGCGGCGGCGGGCGGGGGG + Exonic
1012474186 6:99603305-99603327 CGCGGCCCCCGAGGCGCGGGTGG - Intergenic
1013273288 6:108561181-108561203 CCCAGCCGCGGGCGGGCGGGCGG + Exonic
1013459017 6:110358009-110358031 GGGCGCCGCCGGGGGGCGGCGGG - Exonic
1013619411 6:111873281-111873303 TCTCGCCGCCGGGCGGCGGGCGG + Exonic
1013793516 6:113859796-113859818 CGCGGCCGCCGGGAGCGGGGCGG + Exonic
1015149103 6:130019302-130019324 GGGCGCCGGCGGGGGGCGCGGGG + Intronic
1015149345 6:130020222-130020244 CGCCGCGGCGGCGGGGCGGGGGG + Intronic
1015965385 6:138692393-138692415 CAGGGCCGCCAGGGGGCGGGCGG + Intronic
1016658087 6:146543784-146543806 CGCGGCCGCCGGGGGCGCGGCGG + Exonic
1016949454 6:149566265-149566287 CGCGGCCGCCCGGGGAGGGGAGG + Intergenic
1017163770 6:151390274-151390296 CGGCCCCGCCCCGGGGCGGGTGG - Intronic
1017163879 6:151390638-151390660 CGCCCCCGCCCGCGAGCGGGAGG + Intronic
1017324586 6:153130976-153130998 CGCCCCCGCCGGGGCATGGGCGG + Intronic
1017793900 6:157823874-157823896 CCTCGCCCCCGCGGGGCGGGTGG + Intronic
1017805923 6:157945558-157945580 CGCTGCCCACCGGGGGCGGGGGG - Intergenic
1018613213 6:165662679-165662701 CGCGGCCGGCGGGGGGAGCGCGG - Intronic
1018652899 6:166006138-166006160 AGCAGCCGCGGGCGGGCGGGGGG - Intergenic
1018890106 6:167976993-167977015 CGATGCCGGCGGGGAGCGGGCGG + Intergenic
1019531111 7:1503972-1503994 CGCAGCCGCCGGGAGCCGCGAGG - Exonic
1019989564 7:4682274-4682296 CGCCGCCGCCGGAGGCCGCTCGG + Intergenic
1020130497 7:5556331-5556353 GGCCGCGGGCCGGGGGCGGGAGG - Intronic
1021231099 7:18086896-18086918 CGCCGCCGCCGCCGCGCGGGGGG - Intergenic
1021998481 7:26202111-26202133 CGCCTCCGCCGGAACGCGGGTGG - Intronic
1024247193 7:47479483-47479505 CACCGCCGACGGGGGGGTGGGGG - Intronic
1024940531 7:54759037-54759059 GGCGGCCGTCGCGGGGCGGGCGG - Intronic
1025007657 7:55366546-55366568 CTCCGCCGCGCAGGGGCGGGAGG - Intronic
1025069782 7:55887845-55887867 CGGCGGCGGCGGGCGGCGGGCGG + Intronic
1026765107 7:73155205-73155227 CGCCGCGGACGGGGCGCGGGCGG + Intergenic
1026850319 7:73719556-73719578 CGCTGGCGGCGGGCGGCGGGCGG + Intronic
1026968100 7:74453247-74453269 CGGGGCGGGCGGGGGGCGGGGGG + Intergenic
1027001429 7:74657389-74657411 CGCGGCCGCCCGGGTGGGGGAGG - Intergenic
1027041580 7:74964960-74964982 CGCCGCGGACGGGGCGCGGGCGG + Exonic
1027082062 7:75237409-75237431 CGCCGCGGACGGGGCGCGGGCGG - Intergenic
1028796385 7:94908051-94908073 CGCGTCCACCGTGGGGCGGGGGG + Intronic
1029270574 7:99374760-99374782 GTCCGCGGCCGGGGCGCGGGAGG + Exonic
1029390644 7:100271955-100271977 TGCCGCGGACGGGGCGCGGGCGG - Exonic
1029456862 7:100675965-100675987 CTCCGTTTCCGGGGGGCGGGAGG + Intronic
1029535277 7:101154337-101154359 CGCCGACGCCGCGGGGAGCGCGG - Intergenic
1029640328 7:101816176-101816198 CCCAGCCGCCGGGGGGCCCGCGG + Intronic
1029640454 7:101816509-101816531 AGCGGGCGGCGGGGGGCGGGCGG + Intronic
1029832925 7:103280056-103280078 CTCCCCCGCCCGGGAGCGGGAGG - Intergenic
1029896662 7:103990245-103990267 CGCTGCCGCGAGGGGCCGGGCGG - Intergenic
1030033367 7:105388595-105388617 CGCCCCCGACGGGGCGGGGGTGG + Intronic
1031361929 7:120857757-120857779 GGCAGCCGCCGGCGGGCTGGCGG + Intronic
1031895930 7:127347833-127347855 CGCCGCCGCCTGGCCGCCGGCGG - Intronic
1031966465 7:128031321-128031343 GGCCGCCGCCGGAGGGAGTGCGG + Intronic
1032020706 7:128405964-128405986 CGCTGCTGCCGCGGGCCGGGCGG + Intronic
1032174351 7:129611689-129611711 CGCCGCCGCCGAGGAGGGGGAGG - Intergenic
1033199973 7:139360131-139360153 CGCCGCCGCCTCGAGGCGTGCGG - Exonic
1033361285 7:140640576-140640598 CGGCGCGGCTCGGGGGCGGGCGG + Exonic
1033654374 7:143362821-143362843 CGCCGCGGCCGGGGAGGGGGCGG + Intergenic
1034255169 7:149720791-149720813 AGCAGCCGCAGGGGTGCGGGGGG + Intronic
1034284317 7:149874229-149874251 AGCCGCCGCCCCGGGGCGGAGGG - Intronic
1034469717 7:151248747-151248769 CGGCGGCGGCGGCGGGCGGGCGG - Exonic
1034500751 7:151448867-151448889 CGCGGCCGCCCTGGGGCGTGTGG - Intergenic
1034620288 7:152451665-152451687 AGCCTGCGGCGGGGGGCGGGGGG - Intergenic
1034985894 7:155515296-155515318 GGCCGGGGCCGGGGGGGGGGGGG - Intronic
1035341621 7:158166299-158166321 CGCGGCGGCCGGGGGGGAGGAGG - Intronic
1035361409 7:158316097-158316119 GCCAGCCGCCGGGGGGCAGGTGG + Intronic
1035501693 8:94860-94882 GGCCGCCGCGGTGGGGTGGGCGG - Intergenic
1037337050 8:17801561-17801583 GGCTGGCGCCGGGGGGCGTGGGG - Intergenic
1037827014 8:22165562-22165584 GCCCGTCGCCGGGGGGCCGGGGG - Intronic
1038304039 8:26383290-26383312 CGCCACCGGCGCGGCGCGGGAGG + Intronic
1040039147 8:42897920-42897942 CGGCGCGGCCGGGGAGGGGGAGG + Intronic
1040065599 8:43141303-43141325 CGCCGCCGCCTGGGAGGGGCCGG + Intronic
1040471129 8:47736863-47736885 CTGCGCCACCGGCGGGCGGGCGG + Intergenic
1040501378 8:48008338-48008360 CTCCGCCCCCGGCGGGCGCGGGG - Intergenic
1041244768 8:55879866-55879888 CGCCACGGCCGGGGAGCGAGCGG - Exonic
1042216326 8:66432421-66432443 AGGCGCGGCCGAGGGGCGGGAGG + Intronic
1042532869 8:69833008-69833030 CGCCGCCGCCGCTGGGCCCGCGG + Exonic
1042722987 8:71844243-71844265 CGCCTCCGCCAGGGAGCGGAAGG - Exonic
1043502962 8:80874332-80874354 CGCCGCCGCCCGGGAGCCGCGGG + Intronic
1044719853 8:95134300-95134322 CGCCGCCGCCGCGGGGGGACGGG + Intronic
1044973776 8:97644338-97644360 CGCTGCCACCGCGGGGAGGGCGG - Exonic
1045098930 8:98825861-98825883 CGGCGCGGCCGGGGGCGGGGCGG - Intronic
1045098942 8:98825881-98825903 CGCCGCCGCAGGCTGGCGGCCGG - Intronic
1045305180 8:100951815-100951837 CGCCGCCACCGCGGGGCGAGTGG + Intronic
1049166393 8:141128608-141128630 CCGCGCCGCCTGGGGGCCGGGGG - Exonic
1049427068 8:142542419-142542441 GCCCGCCGCTGGGGGGCTGGCGG - Exonic
1049585387 8:143430479-143430501 CGCCGCCCGCGGGGAGCAGGGGG - Intergenic
1049620939 8:143598012-143598034 GGCCGCGGCCCGGGCGCGGGGGG - Exonic
1049762191 8:144336644-144336666 CGCCGCCCCCGGGGGCATGGGGG - Intergenic
1049762276 8:144336905-144336927 CGGCGGCGGCGGCGGGCGGGGGG + Intergenic
1049762704 8:144338247-144338269 CGCCGCTGCCGGGGCCGGGGCGG - Intergenic
1051287391 9:15510770-15510792 CGACGCCACCGAGGGGGGGGCGG + Intronic
1052362165 9:27573224-27573246 CGCCGCCGCCGGGAAGCCCGGGG + Intronic
1053072932 9:35111617-35111639 CGTGGCCGCCGCGGCGCGGGTGG - Intronic
1053135274 9:35646918-35646940 CGCCGCCGCCTGGCGAGGGGCGG - Intergenic
1053153468 9:35757214-35757236 CCCCGCCGCCGGAGGGAGAGGGG + Exonic
1054489416 9:65762588-65762610 CGGCGGCGGCGGGGGGGGGGTGG - Intergenic
1054835672 9:69672615-69672637 CCCCGGCGCCGGTGGGCGTGCGG + Intergenic
1055321641 9:75088383-75088405 CGCCGCAGCAGGAGCGCGGGCGG - Intergenic
1056243266 9:84669853-84669875 AGGCGCCGCCGGCGGGCGTGAGG + Exonic
1056475095 9:86945882-86945904 CGCCGCTGCCCGGGCGCGGTGGG + Exonic
1056475341 9:86947029-86947051 CGCCACCACCGGGGGCCGAGCGG - Exonic
1056532288 9:87498135-87498157 AGCTGGCGCCGGGGGTCGGGGGG - Intronic
1057146936 9:92764844-92764866 CGGCGGCGCGGGCGGGCGGGCGG - Intergenic
1057432226 9:95004932-95004954 CGGCGGCGCGGGCGGGCGGGCGG - Intronic
1057489151 9:95508376-95508398 CGCCGCCGCCGCGGGGACGGAGG + Exonic
1057489274 9:95508880-95508902 CGCCGCCGCCGCGGGGTCCGAGG + Intronic
1057773157 9:97984458-97984480 CGCCGCCGCCGCGGCACAGGGGG - Intronic
1059191861 9:112333935-112333957 CGGGGCCGCGGGAGGGCGGGCGG - Intergenic
1059234491 9:112750680-112750702 CGCGGCCGCCCGGGAGGGGGCGG - Intergenic
1059412220 9:114139560-114139582 CACCACCGCCTGGGGGCAGGCGG + Intergenic
1059474406 9:114532834-114532856 CGGCGGGGGCGGGGGGCGGGGGG + Intergenic
1059633944 9:116154357-116154379 CGCCGCCGCCGGGCGGTGCCTGG + Exonic
1060478129 9:124000178-124000200 GGCCAGGGCCGGGGGGCGGGGGG - Intergenic
1060952328 9:127612206-127612228 CCCCGCCGCCGGCGCGCGCGGGG - Intergenic
1060979819 9:127785681-127785703 CGCCTCCGCCGGGCTGCGCGGGG - Intronic
1061134259 9:128724159-128724181 CGCCGCCGCCCGGGGACTGGTGG + Intergenic
1061450479 9:130664616-130664638 CCCCGGCGCCGGGGGACGGCCGG - Exonic
1061559679 9:131394352-131394374 GGCCGCCGCCGGGGGCCCGGGGG + Intronic
1062022555 9:134326347-134326369 CGGCGCCGGCGGGGGGGTGGCGG - Intronic
1062022744 9:134326879-134326901 CGGCGGGGCCGGGGGGCGGGTGG + Intronic
1062043302 9:134414009-134414031 CGCTGGCGCCGGAGGCCGGGCGG - Intronic
1062105762 9:134753940-134753962 CGCTGCCGCCGGAGAACGGGAGG - Intronic
1062162473 9:135087837-135087859 CGGCGGCGGCGGCGGGCGGGCGG + Exonic
1062305774 9:135906717-135906739 CGCCGCCAACGGGAGGCTGGGGG + Intronic
1062462009 9:136666056-136666078 CCCTGCCGGCGGCGGGCGGGCGG + Intronic
1202780003 9_KI270717v1_random:24915-24937 CGGCGGCGGCGGGTGGCGGGGGG + Intergenic
1203468643 Un_GL000220v1:107123-107145 CGCGGCGGCCGGCGGGCGGTGGG + Intergenic
1203476464 Un_GL000220v1:151095-151117 CGCGGCGGCCGGCGGGCGGTGGG + Intergenic
1203607143 Un_KI270748v1:68212-68234 GGCCGCCGCGGTGGGGTGGGCGG + Intergenic
1185463827 X:344034-344056 CGTCGCCAACGGGAGGCGGGAGG + Intronic
1185463835 X:344061-344083 CGTCGCCAACGGGAGGCGGGAGG + Intronic
1187507267 X:19887755-19887777 CGCGGCCGCCGGGCGGGGGCGGG + Intergenic
1188242669 X:27809517-27809539 GGCCGGCGGCGGGGGGGGGGCGG - Intronic
1189075024 X:37905862-37905884 CGCCGCCGCCTGGGGGCATCCGG + Intronic
1189446728 X:41086489-41086511 AGCGGCCGCCGGGCGGGGGGCGG - Intronic
1190024611 X:46912351-46912373 CGCGGCCGGCGGTGGGTGGGAGG + Intronic
1199445097 X:147912023-147912045 CGCCGCTGCCAGGGGGCGTGCGG + Intronic
1200098175 X:153673833-153673855 CGGGGCCGGCGGGGCGCGGGCGG - Intronic
1200100947 X:153688887-153688909 CGGCGGCTCCGGGGGTCGGGCGG - Intronic