ID: 942243917

View in Genome Browser
Species Human (GRCh38)
Location 2:173990055-173990077
Sequence TCTCCTGTGTGCTGTGTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942243917_942243923 18 Left 942243917 2:173990055-173990077 CCCATCACACAGCACACAGGAGA No data
Right 942243923 2:173990096-173990118 CAAGCTACTCACCTTTAGGTCGG No data
942243917_942243920 14 Left 942243917 2:173990055-173990077 CCCATCACACAGCACACAGGAGA No data
Right 942243920 2:173990092-173990114 TGCCCAAGCTACTCACCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942243917 Original CRISPR TCTCCTGTGTGCTGTGTGAT GGG (reversed) Intergenic
No off target data available for this crispr