ID: 942243919

View in Genome Browser
Species Human (GRCh38)
Location 2:173990082-173990104
Sequence AGTAGCTTGGGCATAAGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942243919_942243923 -9 Left 942243919 2:173990082-173990104 CCTGTGCTTATGCCCAAGCTACT No data
Right 942243923 2:173990096-173990118 CAAGCTACTCACCTTTAGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942243919 Original CRISPR AGTAGCTTGGGCATAAGCAC AGG (reversed) Intergenic
No off target data available for this crispr