ID: 942243920

View in Genome Browser
Species Human (GRCh38)
Location 2:173990092-173990114
Sequence TGCCCAAGCTACTCACCTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942243917_942243920 14 Left 942243917 2:173990055-173990077 CCCATCACACAGCACACAGGAGA No data
Right 942243920 2:173990092-173990114 TGCCCAAGCTACTCACCTTTAGG No data
942243918_942243920 13 Left 942243918 2:173990056-173990078 CCATCACACAGCACACAGGAGAC No data
Right 942243920 2:173990092-173990114 TGCCCAAGCTACTCACCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942243920 Original CRISPR TGCCCAAGCTACTCACCTTT AGG Intergenic
No off target data available for this crispr