ID: 942243923

View in Genome Browser
Species Human (GRCh38)
Location 2:173990096-173990118
Sequence CAAGCTACTCACCTTTAGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942243917_942243923 18 Left 942243917 2:173990055-173990077 CCCATCACACAGCACACAGGAGA No data
Right 942243923 2:173990096-173990118 CAAGCTACTCACCTTTAGGTCGG No data
942243918_942243923 17 Left 942243918 2:173990056-173990078 CCATCACACAGCACACAGGAGAC No data
Right 942243923 2:173990096-173990118 CAAGCTACTCACCTTTAGGTCGG No data
942243919_942243923 -9 Left 942243919 2:173990082-173990104 CCTGTGCTTATGCCCAAGCTACT No data
Right 942243923 2:173990096-173990118 CAAGCTACTCACCTTTAGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942243923 Original CRISPR CAAGCTACTCACCTTTAGGT CGG Intergenic
No off target data available for this crispr