ID: 942246418

View in Genome Browser
Species Human (GRCh38)
Location 2:174012920-174012942
Sequence TCTGCCGCTCCTCCGCCGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 114}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942246409_942246418 2 Left 942246409 2:174012895-174012917 CCTCTCTCTCCCGCGGGGCCCGG 0: 1
1: 0
2: 2
3: 21
4: 238
Right 942246418 2:174012920-174012942 TCTGCCGCTCCTCCGCCGTGGGG 0: 1
1: 0
2: 0
3: 12
4: 114
942246401_942246418 30 Left 942246401 2:174012867-174012889 CCGCAAACCCACGTGTGAGAGGC 0: 1
1: 0
2: 1
3: 6
4: 114
Right 942246418 2:174012920-174012942 TCTGCCGCTCCTCCGCCGTGGGG 0: 1
1: 0
2: 0
3: 12
4: 114
942246408_942246418 5 Left 942246408 2:174012892-174012914 CCGCCTCTCTCTCCCGCGGGGCC 0: 1
1: 0
2: 0
3: 36
4: 348
Right 942246418 2:174012920-174012942 TCTGCCGCTCCTCCGCCGTGGGG 0: 1
1: 0
2: 0
3: 12
4: 114
942246403_942246418 22 Left 942246403 2:174012875-174012897 CCACGTGTGAGAGGCTCCCGCCT 0: 1
1: 0
2: 1
3: 6
4: 100
Right 942246418 2:174012920-174012942 TCTGCCGCTCCTCCGCCGTGGGG 0: 1
1: 0
2: 0
3: 12
4: 114
942246402_942246418 23 Left 942246402 2:174012874-174012896 CCCACGTGTGAGAGGCTCCCGCC 0: 1
1: 0
2: 1
3: 7
4: 56
Right 942246418 2:174012920-174012942 TCTGCCGCTCCTCCGCCGTGGGG 0: 1
1: 0
2: 0
3: 12
4: 114
942246407_942246418 6 Left 942246407 2:174012891-174012913 CCCGCCTCTCTCTCCCGCGGGGC 0: 1
1: 0
2: 1
3: 45
4: 512
Right 942246418 2:174012920-174012942 TCTGCCGCTCCTCCGCCGTGGGG 0: 1
1: 0
2: 0
3: 12
4: 114
942246413_942246418 -8 Left 942246413 2:174012905-174012927 CCGCGGGGCCCGGGCTCTGCCGC 0: 1
1: 0
2: 4
3: 45
4: 397
Right 942246418 2:174012920-174012942 TCTGCCGCTCCTCCGCCGTGGGG 0: 1
1: 0
2: 0
3: 12
4: 114
942246412_942246418 -7 Left 942246412 2:174012904-174012926 CCCGCGGGGCCCGGGCTCTGCCG 0: 1
1: 0
2: 1
3: 32
4: 287
Right 942246418 2:174012920-174012942 TCTGCCGCTCCTCCGCCGTGGGG 0: 1
1: 0
2: 0
3: 12
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942246418 Original CRISPR TCTGCCGCTCCTCCGCCGTG GGG Intergenic
901160711 1:7174802-7174824 TCTGCCTCGCCTGGGCCGTGGGG - Intronic
903216778 1:21847778-21847800 TCTGCCCTTCCACCACCGTGGGG + Exonic
904093350 1:27960028-27960050 TCTCCTGCTCCTCCGCGGTTGGG - Exonic
904266533 1:29321480-29321502 TCTGCCCCTCCCCAGCCATGTGG - Intronic
904485245 1:30820475-30820497 TCTGCAGCTGCTCTGGCGTGGGG + Intergenic
905580896 1:39082024-39082046 CGCGCCCCTCCTCCGCCGTGGGG + Intronic
907671420 1:56477755-56477777 TCGGCCGTTCCTCCGCGGCGGGG - Intergenic
916120484 1:161524596-161524618 GCTGCCGCTCCGCCGTCGAGGGG - Exonic
916130248 1:161606228-161606250 GCTGCCGCTCCGCCGTCGAGGGG - Intronic
916660726 1:166920673-166920695 TCTGCCTCCCCTCCTCCGAGGGG - Intronic
920171259 1:204073643-204073665 GCTCCTGCTCCTCCTCCGTGCGG - Exonic
922705616 1:227788633-227788655 CCTTCCGCTCCTCCGCCGCCCGG - Intergenic
923879806 1:238091336-238091358 TCTGCAGCTCCTCCGTAGTGGGG + Intergenic
1063157818 10:3396336-3396358 TTTGGGGCTGCTCCGCCGTGTGG - Intergenic
1063352720 10:5371628-5371650 TCTGCAGCTCCTCATCAGTGTGG - Intronic
1065020859 10:21500718-21500740 TCTGCCCCTCCCCCGTCCTGCGG + Intergenic
1065637236 10:27744521-27744543 TCTGCGGCTCCGCGGCCGCGCGG - Intronic
1067405515 10:46019935-46019957 TCTGTCCCTCCTCCTCCCTGTGG + Intronic
1069880105 10:71587155-71587177 TCTGCCGCTCATTTGCCATGCGG - Intronic
1074534371 10:114318361-114318383 TCTGCCCATCCTCCTCCATGGGG + Intronic
1076724046 10:132405136-132405158 TCTCCGGCTCCTCCGGCTTGCGG - Exonic
1076813164 10:132899483-132899505 TCTGTCCCTCCCCGGCCGTGCGG - Intronic
1077251027 11:1560795-1560817 GCTGCCTCTCCTCCTCCCTGTGG + Intronic
1078840701 11:15073747-15073769 TCTGCCTCTCCGCCGCCATCTGG + Intronic
1080656047 11:34259201-34259223 TCTGCCTGTCCTCCACAGTGAGG + Intronic
1081534845 11:43989184-43989206 TCTGCCGCTCATCAGCTGTGTGG + Intergenic
1083762699 11:64827291-64827313 TCTGCTGCTCCTCCGACACGCGG + Exonic
1085516773 11:77116220-77116242 TCTGCCACTCCTCCGAGCTGGGG - Exonic
1089498419 11:118919217-118919239 TCTGCCTCTCCTCCTCCCCGTGG - Intronic
1090204737 11:124878019-124878041 TCTGCAGCTCCTCCCCCGCTGGG - Exonic
1104931003 12:132339436-132339458 TCTGCGGCCCCTCGGCCATGTGG + Intergenic
1105699789 13:22927075-22927097 TCCGCAGCTCGTCCTCCGTGCGG - Intergenic
1112402205 13:99086725-99086747 GCGGCCCCTCCTCCGCCGTCCGG - Intergenic
1112537631 13:100275376-100275398 CCTGCTGCTCCCCAGCCGTGGGG + Intronic
1113584818 13:111458010-111458032 TCTGCTGCTCCCCAGCTGTGTGG + Intergenic
1116774611 14:49165744-49165766 TCTGCCACCCCTCCGTCGTATGG - Intergenic
1119757810 14:77131080-77131102 TCTGCCCCTGCTCCTCCCTGGGG - Intronic
1123630596 15:22257755-22257777 TCCGCCGCCCGTCCGCCGCGCGG + Intergenic
1126940366 15:53759638-53759660 TCTGCCGCTCCTCCGCCCCACGG - Intronic
1128992508 15:72272556-72272578 CCTGCCGCTCCGCCCCCGCGGGG - Exonic
1132544699 16:527857-527879 CCTCCCGCTCCTCAGCCGCGGGG - Exonic
1132599804 16:768429-768451 GGTGCCGCTCCTCCGCCTTCAGG - Exonic
1133101536 16:3483004-3483026 TCTGCCGCTCACTGGCCGTGTGG - Intronic
1134143634 16:11742850-11742872 TCAGCCGCGCCGCCGCCGCGGGG + Exonic
1136429514 16:30188414-30188436 CCAGCCACTCCTCAGCCGTGAGG - Exonic
1138182365 16:54950161-54950183 TCTGCAGCTCATCCTCGGTGGGG - Intergenic
1140427768 16:74875190-74875212 GATGCCGCTCCACCGCCGGGCGG + Intronic
1141431427 16:83972144-83972166 TCTGCAGATTTTCCGCCGTGCGG + Exonic
1144626803 17:16848044-16848066 TCAGCCTCTCCCCCGCCTTGGGG + Intergenic
1144879632 17:18424668-18424690 TCAGCCTCTCCGCCGCCTTGGGG - Intergenic
1145152605 17:20519719-20519741 TCAGCCTCTCCCCCGCCTTGGGG + Intergenic
1145908036 17:28527009-28527031 TCAGCCTCTCCCCTGCCGTGAGG + Intronic
1146689797 17:34865473-34865495 CCTGCGGCTCCTCCACCCTGGGG + Intergenic
1148936296 17:51166605-51166627 TCTCCCGCTCCGACGCCGCGCGG - Exonic
1152929176 17:83101245-83101267 TCTGCCTCTCCCGTGCCGTGGGG + Intergenic
1153015728 18:580816-580838 CCTGCAGCTCCTCATCCGTGAGG - Exonic
1157613787 18:48975512-48975534 TCGGCCCCTCCGCCGCCGTGCGG - Intergenic
1160710605 19:549384-549406 TCTGCCGCTTCCCGGCTGTGTGG - Intronic
1160884050 19:1336579-1336601 CCCGCCATTCCTCCGCCGTGGGG - Intergenic
1161334925 19:3707938-3707960 TCTGCCACTTCCCCGCTGTGTGG - Intergenic
1161435097 19:4258367-4258389 TCCGCCGCTCCTCCTCCGACAGG - Exonic
1162457679 19:10795869-10795891 TCTGCCCTTCCATCGCCGTGGGG + Intronic
1162529238 19:11226242-11226264 TCTGCCCCTTCTCAGTCGTGTGG + Intronic
925027503 2:621272-621294 TCTGAGCCTCCTCCGCCCTGGGG + Intergenic
932773944 2:74515976-74515998 CCTCGCGCTCCTCCGCCGTCTGG - Exonic
942246418 2:174012920-174012942 TCTGCCGCTCCTCCGCCGTGGGG + Intergenic
942660860 2:178263765-178263787 TCTGCCGGTCCTCAGACATGAGG - Intronic
948461343 2:238131321-238131343 GCTTCCGCTCCTCCGCCGGCAGG - Exonic
1172896801 20:38305676-38305698 TCTGCCCCTTGTCCGCTGTGTGG + Intronic
1173944722 20:46941379-46941401 TCTTCTGCTCCTCAGCTGTGTGG + Intronic
1174171863 20:48622678-48622700 TCAGCCTCTCCTCCACCCTGGGG - Intergenic
1175223806 20:57433297-57433319 TCTGCAGCTCCACAGCCATGTGG + Intergenic
1176412189 21:6455065-6455087 TCTGCTGCTCCGCCGCAGGGTGG - Intergenic
1178951597 21:36990173-36990195 GCGGCCGCTCCTGCGCCGGGTGG + Intronic
1179687683 21:43063387-43063409 TCTGCTGCTCCGCCGCAGGGTGG - Intronic
1180049797 21:45325940-45325962 GCTGCCGCTCCCCTGCCATGCGG + Intergenic
1181309771 22:21938291-21938313 GCTGCTGCTCCTCCGCTCTGCGG - Intronic
1183352846 22:37343598-37343620 GCTCCCGCTGCTCAGCCGTGAGG + Intergenic
1185066619 22:48635474-48635496 GCAGCAGCTCCTCCTCCGTGAGG + Intronic
1185291457 22:50029824-50029846 TCAGCCGTTCCTCCCGCGTGGGG - Intronic
952158749 3:30672104-30672126 TCTTCCGCTCCTCAGCCGTCAGG - Exonic
954629109 3:52038704-52038726 TCTGCCCCTCACCTGCCGTGTGG + Intergenic
956467990 3:69537361-69537383 TCTGCAGCTCTTCAGCCTTGAGG - Intronic
961474172 3:127136516-127136538 CCTGCAGCTCCTCTGCCATGAGG - Intergenic
970609093 4:17709119-17709141 CCTGCAGCTCCTCGGCCTTGCGG + Exonic
977685030 4:99837683-99837705 TCTGCCGCTGCTCCGGTCTGTGG - Intronic
981782819 4:148445358-148445380 TCTGCCCCACCCCCGCCGTGGGG + Intergenic
985171831 4:187158226-187158248 TCTGCAGCTCCTCAACGGTGTGG + Intergenic
992716335 5:79514316-79514338 TCAGCCTCTCCGCCGCCTTGCGG - Intergenic
994171538 5:96663091-96663113 TCGCCGGCTCCCCCGCCGTGCGG + Intronic
1002965675 6:1963952-1963974 TCTGCTGCTCCTAGGCAGTGTGG - Intronic
1003559679 6:7170389-7170411 TCTGCTGCTCCTGGGCAGTGAGG - Intronic
1004879024 6:19987192-19987214 TCTCCCACTCCTCTCCCGTGTGG - Intergenic
1006689773 6:35872571-35872593 TCTGGAGCTCCTCCGCCTTCCGG - Exonic
1007113436 6:39326939-39326961 TCTGCCGTTTCTCTGCCTTGGGG + Intergenic
1016923334 6:149317437-149317459 CCTGCTGCTCCCCCGCCGTTCGG + Intronic
1018887415 6:167951647-167951669 TCTCCCGCTCCTCCTCCAGGCGG - Exonic
1019466716 7:1193706-1193728 TCTGCCGCTCCCCAGCTGTGTGG + Intergenic
1019618826 7:1979585-1979607 TCTGCCTCTCCCCCGCCTTGTGG - Intronic
1029706876 7:102280791-102280813 TCTGCCGCTCCTGCACAGGGAGG - Intronic
1034330834 7:150280954-150280976 TCTGCCACACCTGCGCCTTGAGG - Intronic
1034667208 7:152828899-152828921 TCTGCCACACCTGCGCCTTGAGG + Intronic
1035720087 8:1785172-1785194 TCTCCCGCTCCTCAGGCTTGCGG + Exonic
1036258193 8:7221539-7221561 GCTGCCGCTTCTCGGCTGTGTGG - Intergenic
1036310240 8:7680135-7680157 GCTGCCGCTTCTCGGCTGTGTGG - Intergenic
1036359295 8:8065968-8065990 GCTGCCGCTTCTCGGCTGTGTGG + Intergenic
1036891662 8:12600984-12601006 GCTGCCGCTTCTCGGCTGTGTGG - Intergenic
1045583273 8:103500979-103501001 TTTTCCTCTCCTCCTCCGTGAGG - Intronic
1046695277 8:117332882-117332904 CCTGCTGCACCTCCGCAGTGAGG - Intergenic
1049991966 9:999186-999208 CCTGCCGGTCCTGCGCCGTGGGG - Intergenic
1057180919 9:93029797-93029819 GCTGCCACTCCACTGCCGTGTGG + Intronic
1057390776 9:94639921-94639943 TCTGCAGCTCCTGCCCCGTGTGG + Intronic
1061794061 9:133073804-133073826 GCTGCCGCTCCCCAGCTGTGTGG - Intronic
1062197750 9:135283789-135283811 TCAGCCCCTCCTCTGCTGTGGGG + Intergenic
1062449566 9:136609839-136609861 GCTGCCGCCCCTGCGCCCTGGGG + Intergenic
1062672928 9:137722558-137722580 TCTGCCGCACCACCTCCGTGGGG - Intronic
1062672948 9:137722637-137722659 TCTGCCGCACCACCTCCGTGGGG - Intronic
1062672972 9:137722711-137722733 TCTGCCGCACCACCTCTGTGGGG - Intronic
1062672991 9:137722789-137722811 TCTGCCACACCACCTCCGTGGGG - Intronic
1185431649 X:14763-14785 TCCGCCGCTCCTCGGCCTCGTGG - Intergenic
1185432912 X:19778-19800 TCCGCCGCTCCTCGGCCTCGTGG - Intergenic
1185440973 X:227482-227504 TCCGCCGCTCCTCGGCCTCGTGG - Intergenic
1185442264 X:232600-232622 TCCGCCGCTCCTCGGCCTCGTGG - Intergenic
1191105940 X:56772471-56772493 TCTGCCCCTCCTCCAAAGTGGGG - Intergenic
1191106933 X:56777873-56777895 TCTGCCCCTCCTCCAAAGTGGGG - Intergenic
1191984332 X:66962182-66962204 TCTGCTGCTCCTGGGCAGTGGGG + Intergenic
1196398382 X:115289685-115289707 TCTGCTCCTCCTGCGCGGTGAGG + Intergenic