ID: 942247886

View in Genome Browser
Species Human (GRCh38)
Location 2:174024115-174024137
Sequence GGCCACGGTGATGGTTCCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942247876_942247886 18 Left 942247876 2:174024074-174024096 CCCTGGCTGGGAACTGGAGCTGT No data
Right 942247886 2:174024115-174024137 GGCCACGGTGATGGTTCCTGCGG No data
942247877_942247886 17 Left 942247877 2:174024075-174024097 CCTGGCTGGGAACTGGAGCTGTG No data
Right 942247886 2:174024115-174024137 GGCCACGGTGATGGTTCCTGCGG No data
942247881_942247886 -10 Left 942247881 2:174024102-174024124 CCCCTGCAGGCCTGGCCACGGTG No data
Right 942247886 2:174024115-174024137 GGCCACGGTGATGGTTCCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942247886 Original CRISPR GGCCACGGTGATGGTTCCTG CGG Intergenic
No off target data available for this crispr