ID: 942248727

View in Genome Browser
Species Human (GRCh38)
Location 2:174030158-174030180
Sequence TCTCGTGTGCTGGAGGTTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942248721_942248727 -6 Left 942248721 2:174030141-174030163 CCCTTGGCCTTGGTGACTCTCGT No data
Right 942248727 2:174030158-174030180 TCTCGTGTGCTGGAGGTTAAGGG No data
942248722_942248727 -7 Left 942248722 2:174030142-174030164 CCTTGGCCTTGGTGACTCTCGTG No data
Right 942248727 2:174030158-174030180 TCTCGTGTGCTGGAGGTTAAGGG No data
942248718_942248727 4 Left 942248718 2:174030131-174030153 CCCGTCTCGTCCCTTGGCCTTGG No data
Right 942248727 2:174030158-174030180 TCTCGTGTGCTGGAGGTTAAGGG No data
942248720_942248727 3 Left 942248720 2:174030132-174030154 CCGTCTCGTCCCTTGGCCTTGGT No data
Right 942248727 2:174030158-174030180 TCTCGTGTGCTGGAGGTTAAGGG No data
942248717_942248727 5 Left 942248717 2:174030130-174030152 CCCCGTCTCGTCCCTTGGCCTTG No data
Right 942248727 2:174030158-174030180 TCTCGTGTGCTGGAGGTTAAGGG No data
942248714_942248727 20 Left 942248714 2:174030115-174030137 CCACCTGAGTCGGCTCCCCGTCT No data
Right 942248727 2:174030158-174030180 TCTCGTGTGCTGGAGGTTAAGGG No data
942248715_942248727 17 Left 942248715 2:174030118-174030140 CCTGAGTCGGCTCCCCGTCTCGT No data
Right 942248727 2:174030158-174030180 TCTCGTGTGCTGGAGGTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942248727 Original CRISPR TCTCGTGTGCTGGAGGTTAA GGG Intergenic
No off target data available for this crispr