ID: 942249309

View in Genome Browser
Species Human (GRCh38)
Location 2:174034100-174034122
Sequence CCCCTGGATGTCTCCATTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942249309_942249317 -2 Left 942249309 2:174034100-174034122 CCCCAAATGGAGACATCCAGGGG No data
Right 942249317 2:174034121-174034143 GGACTTTAGATGGATGGGTCTGG No data
942249309_942249314 -8 Left 942249309 2:174034100-174034122 CCCCAAATGGAGACATCCAGGGG No data
Right 942249314 2:174034115-174034137 TCCAGGGGACTTTAGATGGATGG No data
942249309_942249323 29 Left 942249309 2:174034100-174034122 CCCCAAATGGAGACATCCAGGGG No data
Right 942249323 2:174034152-174034174 AGATGCTCTTGGCTTAGGAAGGG No data
942249309_942249322 28 Left 942249309 2:174034100-174034122 CCCCAAATGGAGACATCCAGGGG No data
Right 942249322 2:174034151-174034173 CAGATGCTCTTGGCTTAGGAAGG No data
942249309_942249319 0 Left 942249309 2:174034100-174034122 CCCCAAATGGAGACATCCAGGGG No data
Right 942249319 2:174034123-174034145 ACTTTAGATGGATGGGTCTGGGG No data
942249309_942249321 24 Left 942249309 2:174034100-174034122 CCCCAAATGGAGACATCCAGGGG No data
Right 942249321 2:174034147-174034169 TGAGCAGATGCTCTTGGCTTAGG No data
942249309_942249320 18 Left 942249309 2:174034100-174034122 CCCCAAATGGAGACATCCAGGGG No data
Right 942249320 2:174034141-174034163 TGGGGATGAGCAGATGCTCTTGG No data
942249309_942249318 -1 Left 942249309 2:174034100-174034122 CCCCAAATGGAGACATCCAGGGG No data
Right 942249318 2:174034122-174034144 GACTTTAGATGGATGGGTCTGGG No data
942249309_942249316 -7 Left 942249309 2:174034100-174034122 CCCCAAATGGAGACATCCAGGGG No data
Right 942249316 2:174034116-174034138 CCAGGGGACTTTAGATGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942249309 Original CRISPR CCCCTGGATGTCTCCATTTG GGG (reversed) Intergenic
No off target data available for this crispr