ID: 942251093

View in Genome Browser
Species Human (GRCh38)
Location 2:174048458-174048480
Sequence CGCGAGTGGCAGCCGGCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942251093_942251104 8 Left 942251093 2:174048458-174048480 CCCGCAGCCGGCTGCCACTCGCG No data
Right 942251104 2:174048489-174048511 GGGCAGCGGAGGGACGCGCCCGG No data
942251093_942251106 10 Left 942251093 2:174048458-174048480 CCCGCAGCCGGCTGCCACTCGCG No data
Right 942251106 2:174048491-174048513 GCAGCGGAGGGACGCGCCCGGGG No data
942251093_942251107 22 Left 942251093 2:174048458-174048480 CCCGCAGCCGGCTGCCACTCGCG No data
Right 942251107 2:174048503-174048525 CGCGCCCGGGGCGCAACCCGCGG No data
942251093_942251105 9 Left 942251093 2:174048458-174048480 CCCGCAGCCGGCTGCCACTCGCG No data
Right 942251105 2:174048490-174048512 GGCAGCGGAGGGACGCGCCCGGG No data
942251093_942251099 -6 Left 942251093 2:174048458-174048480 CCCGCAGCCGGCTGCCACTCGCG No data
Right 942251099 2:174048475-174048497 CTCGCGCCCACGAAGGGCAGCGG No data
942251093_942251101 -2 Left 942251093 2:174048458-174048480 CCCGCAGCCGGCTGCCACTCGCG No data
Right 942251101 2:174048479-174048501 CGCCCACGAAGGGCAGCGGAGGG No data
942251093_942251100 -3 Left 942251093 2:174048458-174048480 CCCGCAGCCGGCTGCCACTCGCG No data
Right 942251100 2:174048478-174048500 GCGCCCACGAAGGGCAGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942251093 Original CRISPR CGCGAGTGGCAGCCGGCTGC GGG (reversed) Intergenic
No off target data available for this crispr