ID: 942252052 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:174055446-174055468 |
| Sequence | GCAAATTCTGCCGGGCGCGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 942252052_942252056 | 12 | Left | 942252052 | 2:174055446-174055468 | CCACCGCGCCCGGCAGAATTTGC | No data | ||
| Right | 942252056 | 2:174055481-174055503 | TATGATATTTCTGCATAGTTCGG | No data | ||||
| 942252052_942252057 | 13 | Left | 942252052 | 2:174055446-174055468 | CCACCGCGCCCGGCAGAATTTGC | No data | ||
| Right | 942252057 | 2:174055482-174055504 | ATGATATTTCTGCATAGTTCGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 942252052 | Original CRISPR | GCAAATTCTGCCGGGCGCGG TGG (reversed) | Intergenic | ||