ID: 942265306

View in Genome Browser
Species Human (GRCh38)
Location 2:174218750-174218772
Sequence CAGCAAACCCCAGGGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942265300_942265306 -10 Left 942265300 2:174218737-174218759 CCTTTACATTAGGCAGCAAACCC No data
Right 942265306 2:174218750-174218772 CAGCAAACCCCAGGGGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942265306 Original CRISPR CAGCAAACCCCAGGGGTGGG AGG Intronic
No off target data available for this crispr