ID: 942267022

View in Genome Browser
Species Human (GRCh38)
Location 2:174238351-174238373
Sequence TATAGGCATGCGCCACCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942267022_942267027 2 Left 942267022 2:174238351-174238373 CCTGGTGGTGGCGCATGCCTATA No data
Right 942267027 2:174238376-174238398 CCCTGTTACTTAGGAGGCTGAGG No data
942267022_942267029 6 Left 942267022 2:174238351-174238373 CCTGGTGGTGGCGCATGCCTATA No data
Right 942267029 2:174238380-174238402 GTTACTTAGGAGGCTGAGGCAGG 0: 123
1: 8010
2: 171224
3: 267791
4: 183346
942267022_942267030 25 Left 942267022 2:174238351-174238373 CCTGGTGGTGGCGCATGCCTATA No data
Right 942267030 2:174238399-174238421 CAGGAGAATCACTTGAACCCAGG 0: 34141
1: 101530
2: 153868
3: 199323
4: 172421
942267022_942267025 -4 Left 942267022 2:174238351-174238373 CCTGGTGGTGGCGCATGCCTATA No data
Right 942267025 2:174238370-174238392 TATAATCCCTGTTACTTAGGAGG No data
942267022_942267031 28 Left 942267022 2:174238351-174238373 CCTGGTGGTGGCGCATGCCTATA No data
Right 942267031 2:174238402-174238424 GAGAATCACTTGAACCCAGGAGG 0: 21628
1: 64917
2: 122797
3: 157734
4: 166761
942267022_942267023 -7 Left 942267022 2:174238351-174238373 CCTGGTGGTGGCGCATGCCTATA No data
Right 942267023 2:174238367-174238389 GCCTATAATCCCTGTTACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942267022 Original CRISPR TATAGGCATGCGCCACCACC AGG (reversed) Intronic
No off target data available for this crispr