ID: 942267591

View in Genome Browser
Species Human (GRCh38)
Location 2:174243928-174243950
Sequence ATCTACAAGATATAGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942267591_942267594 5 Left 942267591 2:174243928-174243950 CCCACAATCTATATCTTGTAGAT No data
Right 942267594 2:174243956-174243978 CAGAAGCACACAAGTCCGGTCGG No data
942267591_942267597 26 Left 942267591 2:174243928-174243950 CCCACAATCTATATCTTGTAGAT No data
Right 942267597 2:174243977-174243999 GGATTTCCTTACTCAGGAATTGG No data
942267591_942267593 1 Left 942267591 2:174243928-174243950 CCCACAATCTATATCTTGTAGAT No data
Right 942267593 2:174243952-174243974 TATACAGAAGCACACAAGTCCGG No data
942267591_942267596 20 Left 942267591 2:174243928-174243950 CCCACAATCTATATCTTGTAGAT No data
Right 942267596 2:174243971-174243993 CCGGTCGGATTTCCTTACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942267591 Original CRISPR ATCTACAAGATATAGATTGT GGG (reversed) Intronic
No off target data available for this crispr