ID: 942272062

View in Genome Browser
Species Human (GRCh38)
Location 2:174286382-174286404
Sequence CTGGTGAGCAGCTGAATTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942272060_942272062 0 Left 942272060 2:174286359-174286381 CCATCAAATTAGCAGAACAACTT No data
Right 942272062 2:174286382-174286404 CTGGTGAGCAGCTGAATTCTAGG No data
942272058_942272062 14 Left 942272058 2:174286345-174286367 CCCAACAGACAAGGCCATCAAAT No data
Right 942272062 2:174286382-174286404 CTGGTGAGCAGCTGAATTCTAGG No data
942272057_942272062 20 Left 942272057 2:174286339-174286361 CCTGCTCCCAACAGACAAGGCCA No data
Right 942272062 2:174286382-174286404 CTGGTGAGCAGCTGAATTCTAGG No data
942272059_942272062 13 Left 942272059 2:174286346-174286368 CCAACAGACAAGGCCATCAAATT No data
Right 942272062 2:174286382-174286404 CTGGTGAGCAGCTGAATTCTAGG No data
942272055_942272062 28 Left 942272055 2:174286331-174286353 CCTTTCTTCCTGCTCCCAACAGA No data
Right 942272062 2:174286382-174286404 CTGGTGAGCAGCTGAATTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942272062 Original CRISPR CTGGTGAGCAGCTGAATTCT AGG Intergenic
No off target data available for this crispr