ID: 942273450

View in Genome Browser
Species Human (GRCh38)
Location 2:174300194-174300216
Sequence ACAATAACCTGACTGCCTTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 103}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942273450_942273454 25 Left 942273450 2:174300194-174300216 CCGCAAGGCAGTCAGGTTATTGT 0: 1
1: 0
2: 0
3: 7
4: 103
Right 942273454 2:174300242-174300264 GACATCCTCAGGACACAGACTGG 0: 1
1: 0
2: 2
3: 18
4: 202
942273450_942273453 14 Left 942273450 2:174300194-174300216 CCGCAAGGCAGTCAGGTTATTGT 0: 1
1: 0
2: 0
3: 7
4: 103
Right 942273453 2:174300231-174300253 CACTGCAAATAGACATCCTCAGG 0: 1
1: 0
2: 0
3: 16
4: 97
942273450_942273455 26 Left 942273450 2:174300194-174300216 CCGCAAGGCAGTCAGGTTATTGT 0: 1
1: 0
2: 0
3: 7
4: 103
Right 942273455 2:174300243-174300265 ACATCCTCAGGACACAGACTGGG 0: 1
1: 0
2: 1
3: 20
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942273450 Original CRISPR ACAATAACCTGACTGCCTTG CGG (reversed) Intergenic