ID: 942273525

View in Genome Browser
Species Human (GRCh38)
Location 2:174300960-174300982
Sequence GGGAGCACGAAATTACCCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942273521_942273525 -4 Left 942273521 2:174300941-174300963 CCACTTTGTATCCCATTTTGGGA 0: 1
1: 0
2: 4
3: 14
4: 172
Right 942273525 2:174300960-174300982 GGGAGCACGAAATTACCCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942273525 Original CRISPR GGGAGCACGAAATTACCCGT GGG Intergenic
No off target data available for this crispr