ID: 942275586

View in Genome Browser
Species Human (GRCh38)
Location 2:174320476-174320498
Sequence CAGGTATAGCATCTTGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942275577_942275586 28 Left 942275577 2:174320425-174320447 CCCAGTTTTAGATCTTACATAAG No data
Right 942275586 2:174320476-174320498 CAGGTATAGCATCTTGCAGATGG No data
942275576_942275586 29 Left 942275576 2:174320424-174320446 CCCCAGTTTTAGATCTTACATAA No data
Right 942275586 2:174320476-174320498 CAGGTATAGCATCTTGCAGATGG No data
942275578_942275586 27 Left 942275578 2:174320426-174320448 CCAGTTTTAGATCTTACATAAGG No data
Right 942275586 2:174320476-174320498 CAGGTATAGCATCTTGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942275586 Original CRISPR CAGGTATAGCATCTTGCAGA TGG Intergenic
No off target data available for this crispr