ID: 942278529

View in Genome Browser
Species Human (GRCh38)
Location 2:174340298-174340320
Sequence CTGGAGGCCCAGAGGGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 590
Summary {0: 1, 1: 0, 2: 7, 3: 58, 4: 524}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942278523_942278529 1 Left 942278523 2:174340274-174340296 CCGGAGGGGCTTCGGGCCGGGGC 0: 1
1: 0
2: 0
3: 23
4: 174
Right 942278529 2:174340298-174340320 CTGGAGGCCCAGAGGGTGCCTGG 0: 1
1: 0
2: 7
3: 58
4: 524
942278513_942278529 23 Left 942278513 2:174340252-174340274 CCGGCTGGCAGGGACGCGTTTTC 0: 1
1: 0
2: 0
3: 3
4: 60
Right 942278529 2:174340298-174340320 CTGGAGGCCCAGAGGGTGCCTGG 0: 1
1: 0
2: 7
3: 58
4: 524

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942278529 Original CRISPR CTGGAGGCCCAGAGGGTGCC TGG Intergenic
900087662 1:906093-906115 CAGGAGGCCCAGAAGGAGCGGGG - Intergenic
900092011 1:924688-924710 CTCGAGGGCCAGCGGGTCCCTGG - Intergenic
900140159 1:1136471-1136493 GTGGAGGCCCTGTGGGTGCTGGG + Intergenic
900144194 1:1150839-1150861 CTAGAGGCCCAGAGGGAATCTGG - Intergenic
900337224 1:2170238-2170260 CTGGAGGCCCCTCGGCTGCCAGG - Intronic
900337236 1:2170279-2170301 CTGGAGGTCCCGCGGCTGCCGGG - Intronic
900391121 1:2434380-2434402 CCAGAGGCCCTGTGGGTGCCCGG - Intronic
900519153 1:3097365-3097387 CTGGAAGCCCAGAGTGTGCTGGG - Intronic
900567072 1:3338729-3338751 CTGGAGCCCCAGAGGCAGCCAGG + Intronic
900600667 1:3501454-3501476 CTGCAGCCCCAGGAGGTGCCCGG - Intronic
900646866 1:3712978-3713000 CTGGGGGCCCTGAGGGTCACAGG - Intronic
900689391 1:3971109-3971131 CTGGGGCCCCAGGGGGTGTCAGG + Intergenic
900704118 1:4068196-4068218 CTGGAAGCCCAGAGTGGGCCTGG + Intergenic
900716724 1:4149600-4149622 CAGGAGGCCCACCTGGTGCCTGG - Intergenic
901037664 1:6346056-6346078 CTGGAAGCAGAGAGGGAGCCAGG + Intronic
901145639 1:7062773-7062795 CTGGAGCCCCAGCGGAAGCCTGG - Intronic
901207524 1:7505510-7505532 GTGCAGGCCCAGATGGGGCCGGG + Intronic
901882667 1:12203325-12203347 GAGGCGGCCCAGAGGGAGCCTGG - Intronic
902374344 1:16023255-16023277 CTGGGGACCCAGAGGATACCTGG + Intronic
902379299 1:16045133-16045155 CTGGGGACCCAGAGGATACCTGG + Intronic
902681575 1:18047592-18047614 CAGGAGGCTCGGAGGGAGCCAGG + Intergenic
902922711 1:19676612-19676634 CTGGAGGCCTAGAAAGAGCCGGG + Intronic
903050052 1:20593968-20593990 CTGGACACCCAGAGGAAGCCTGG + Intronic
903206049 1:21783234-21783256 CGGGAGGCGCAGAGGCTGCTGGG - Exonic
903358581 1:22763020-22763042 CTCGAGGCCCAGAGAGTGCTGGG + Intronic
903734725 1:25522860-25522882 CTGGAGGCTCAGAGAGGGCAAGG - Intergenic
904261547 1:29290543-29290565 GTGCAGGCCCAGAGGGCGCCAGG + Intronic
904697455 1:32338233-32338255 CCAGAGCCCCAGAGGGAGCCTGG + Intergenic
904773281 1:32893001-32893023 CTGGAGGGCCAGAGGCAGCTGGG - Intronic
904928539 1:34067507-34067529 CAGGAGCCCCAGGGGCTGCCAGG + Intronic
904975061 1:34449605-34449627 CTGGAGGCAGAGGGAGTGCCTGG - Intergenic
905280932 1:36849096-36849118 CTGGATGCCGACAGGATGCCTGG + Intronic
905880011 1:41457322-41457344 CAGGGGGCCCAGAGGGTTCCGGG + Intergenic
905937209 1:41834101-41834123 CCCCAGGCCCAGAGGGAGCCGGG - Intronic
906143416 1:43546583-43546605 CTGAAGGCCCTGAAAGTGCCTGG - Intronic
906518336 1:46452657-46452679 CGGGAGGCCCAGAGGAGGCCAGG - Intergenic
906731824 1:48089506-48089528 CTGGAGTTCCAGCTGGTGCCCGG + Intergenic
906895217 1:49763703-49763725 CTGGAGGCCCTGGGGGAGTCAGG - Intronic
907224016 1:52927911-52927933 CTGGAGGGACAGAGGGAGGCCGG - Intronic
907457166 1:54583153-54583175 GTGGAGGCCTGCAGGGTGCCAGG - Intronic
907714811 1:56916883-56916905 ATGGAGCCGCAGAGGGTGACAGG - Intronic
908480656 1:64535803-64535825 CCAGAGGCCCAGAGGAAGCCAGG - Intronic
909649721 1:77960414-77960436 CTGGAGGCCCAGGAGGTCCATGG + Exonic
910326714 1:86017159-86017181 CTGGAGGGCCAGATGGTCCTTGG + Exonic
910935500 1:92482864-92482886 CTGGAGACGCGGAGGGTGACGGG + Exonic
912100875 1:106202519-106202541 CTGGAGTCCCAGAGGCTAACTGG + Intergenic
912272808 1:108228043-108228065 CTGGAGCCCCTGGGGCTGCCTGG - Intronic
912295412 1:108466279-108466301 CTGGAGCCCCTGGGGCTGCCTGG + Intronic
912520456 1:110241094-110241116 ACCGAGGCCCAGAGGGAGCCTGG - Intronic
912822772 1:112881070-112881092 CTGGATGCCCAAGGGGAGCCGGG + Intergenic
913599128 1:120405974-120405996 CTGGAGCCCCTGGGGCTGCCTGG + Intergenic
914088250 1:144473646-144473668 CTGGAGCCCCTGGGGCTGCCTGG - Intergenic
914310361 1:146460564-146460586 CTGGAGCCCCTGGGGCTGCCTGG + Intergenic
914314823 1:146500190-146500212 CTGGAGCCCCTGGGGCTGCCAGG - Intergenic
914499528 1:148233198-148233220 CTGGAGCCCCTGGGGCTGCCAGG + Intergenic
914591748 1:149112578-149112600 CTGGAGCCCCTGGGGCTGCCTGG - Intergenic
914987128 1:152470767-152470789 GTAGAGGCCCAGTGGGTGTCTGG + Intergenic
915599929 1:156915663-156915685 CAGAAGGCCTACAGGGTGCCAGG + Exonic
916184003 1:162113341-162113363 CTGGCGGCCCAGTGGGGTCCTGG + Intronic
917186210 1:172359048-172359070 CTGGTGGCTCAGACGGGGCCTGG + Intronic
918076546 1:181175395-181175417 CTGGAGCGGCAGAGGCTGCCAGG + Intergenic
918078713 1:181189987-181190009 CTGGAGGCCCAGAGGGCACCCGG - Intergenic
918098563 1:181354260-181354282 CTCTAGGCCCAGAATGTGCCTGG - Intergenic
918519940 1:185404335-185404357 CTGGAAGTCGAGAGGATGCCGGG + Intergenic
919780415 1:201217310-201217332 CTGGAGGCCGACAGGATGGCTGG - Exonic
920048013 1:203146059-203146081 CTGGGAGCCCAGGGGCTGCCTGG + Intronic
920052234 1:203171201-203171223 CTGTAGGCCCAGAGTGTGAGAGG + Intronic
920234589 1:204494433-204494455 CTGGAGCCGCAGAGCGAGCCCGG - Intronic
922738258 1:228001327-228001349 CTGTAGGCCCACTGTGTGCCCGG - Intergenic
922763852 1:228147765-228147787 CTGGGGACCCACAGGGTCCCTGG - Intronic
922772227 1:228192095-228192117 CTGGGGGCCCATAGGGTGCTGGG + Intergenic
922803322 1:228373730-228373752 CTGGAGGTGGGGAGGGTGCCTGG + Intronic
924042413 1:239997479-239997501 CTGAAGGCCCAGGTGGTGACCGG - Intergenic
1062930073 10:1347089-1347111 GTGCAGGCCCAGAGGGGCCCAGG + Intronic
1062938264 10:1403703-1403725 CTGCAGGCCGAGTGGGTCCCAGG - Intronic
1063429814 10:5978133-5978155 CTGGGGCCCCAGCGGGCGCCGGG - Intronic
1063559738 10:7114755-7114777 CTGGGGGCCCACAGTGAGCCAGG - Intergenic
1066642575 10:37571077-37571099 CTGGGGACCCAGAGGGAGACAGG - Intergenic
1067187788 10:44044813-44044835 CTTGAGGTCCAGAGGGGGCTGGG + Intergenic
1067456890 10:46425514-46425536 TTGGAGGCCCAGAGGGTAGGGGG - Intergenic
1067630313 10:47959125-47959147 TTGGAGGCCCAGAGGGTAGGGGG + Intergenic
1067834973 10:49632820-49632842 CATGAGGCCCACAGGGTTCCAGG + Intronic
1068798671 10:61114348-61114370 ATAGTGACCCAGAGGGTGCCTGG + Intergenic
1069486596 10:68827678-68827700 CTGGAGGCGCAGAAGGCGGCGGG + Exonic
1069486683 10:68828014-68828036 CTGGAGGCGCAGAAGGCGGCGGG + Intronic
1069574466 10:69516930-69516952 CTGGGGGCCCAGACAGTGCAGGG - Intergenic
1069713556 10:70506495-70506517 CTGGACTCCAAGAGCGTGCCAGG - Intronic
1070730882 10:78827440-78827462 CGGCAGGCCCAGAGGATTCCAGG + Intergenic
1071488867 10:86122549-86122571 CTGGAGCTCCACTGGGTGCCTGG + Intronic
1071532556 10:86400923-86400945 CTGGAGGCAGAGAGAGCGCCTGG + Intergenic
1073242377 10:102066876-102066898 CTGAAGGCCCAGCTGGTGGCTGG + Exonic
1074138051 10:110644550-110644572 CTCGCGGGCCGGAGGGTGCCGGG - Exonic
1074443845 10:113501793-113501815 TTGGAAGCCCAGAGTGTGGCTGG - Intergenic
1074912665 10:117925601-117925623 CTGGTGGCCCAGAGAGTGGGAGG - Intergenic
1075726391 10:124612965-124612987 CTGGAGGCCCAGAGGGAGCTGGG + Intronic
1076031017 10:127158539-127158561 CTGAACGCCCAGAAGGTACCAGG - Intronic
1076582360 10:131520264-131520286 CAGGAGTCCCAGAGGGTCCTTGG + Intergenic
1076692478 10:132230829-132230851 CAGGAGGGGCAGAGGGAGCCTGG - Intronic
1076778691 10:132711886-132711908 CCAGAGGCTCAGAGGGTACCAGG - Intronic
1076816083 10:132915326-132915348 CTGGAGGCCCGGGGTGGGCCTGG + Intronic
1076867994 10:133178648-133178670 CAGGAGGCACAGAGGCAGCCAGG - Intronic
1076875056 10:133211701-133211723 CAGGAGGCCCAGCAGGTGCTTGG - Exonic
1077048278 11:555599-555621 CTGGAGGACCAGGGGGCGGCCGG + Intronic
1077105580 11:841039-841061 CTGGAGGTCTTGAGGGTGACTGG - Intronic
1077233856 11:1470598-1470620 TTGTAGGCCCTGAGGGTGGCAGG - Intronic
1077366187 11:2162287-2162309 GTGGGGGCTGAGAGGGTGCCTGG - Intergenic
1077543218 11:3157398-3157420 GGGGAGGCCAAGAGGGGGCCTGG + Intronic
1079156971 11:17956943-17956965 CTCGAGGCCAAGAGAGAGCCAGG - Intronic
1081605438 11:44524620-44524642 GAGCAGGCCCAGAGGGAGCCGGG - Intergenic
1082767579 11:57181436-57181458 CTGGAGTCCAAGGGGGTCCCAGG - Intergenic
1083148496 11:60775655-60775677 CAGGGGGCGCAGAGGCTGCCGGG - Exonic
1083187250 11:61024880-61024902 AAGGAGCCCAAGAGGGTGCCCGG - Intergenic
1083325277 11:61869910-61869932 CAGGAGGCCCAGCGGCTGGCTGG + Intergenic
1083631146 11:64096130-64096152 CTGGAGGCCAGGAGGGGACCAGG + Intronic
1083669773 11:64293115-64293137 CAGCAGGCCCAGAGGGAGCTGGG + Exonic
1083678808 11:64342073-64342095 CTGCAGGGCCAGATGGTGCGAGG - Exonic
1084426266 11:69086011-69086033 CTGGACGCCCGGAGCGTGGCTGG + Intronic
1084671472 11:70609123-70609145 CGGGCGGCCCAGAGAGGGCCTGG + Intronic
1085040810 11:73325241-73325263 CTAGGGGCCCAGAGGGAGACAGG - Intronic
1088318433 11:108530748-108530770 CTAAAGGGCCAGAGGGTGCCTGG + Intronic
1088455950 11:110033275-110033297 CAGGAGGTGCAGAGGGTTCCAGG + Intergenic
1088686477 11:112288457-112288479 CTGGAGGCCAAGAAGGAGCTGGG + Intergenic
1088912987 11:114206059-114206081 CTGGATGTCAAGAGGGAGCCTGG + Intronic
1089002880 11:115067017-115067039 CTGGAGGAGCAGTGGGTGCCTGG - Intergenic
1091110532 11:132962358-132962380 CTGCAGACCAAGAGTGTGCCTGG + Intronic
1091168137 11:133498514-133498536 TGGGAGGCCCAGATGGTGCGAGG - Intronic
1091357192 11:134946188-134946210 CTGCAAGCCCAGAGGGCCCCAGG + Intergenic
1091388802 12:112536-112558 CTGGAAGCCCAGGTGCTGCCTGG - Intronic
1091565572 12:1645728-1645750 GAAGAGGCCCAGAGGGTGGCTGG - Intronic
1091986362 12:4912295-4912317 CTGGAGGCCCTTAGAGTGGCGGG - Exonic
1095955459 12:47803229-47803251 CAGGAGACCCAGAGGCTGCCTGG + Intronic
1101038889 12:100733912-100733934 CTGGAGGTCAAGGGGGTGGCTGG + Intronic
1103035247 12:117651333-117651355 CTCAAGTCCCAGAGGGTCCCTGG + Intronic
1103200301 12:119082677-119082699 CTGGAGGCCCAGGGTGGGGCTGG - Intronic
1103700524 12:122846756-122846778 GGGGCGGCCCAGAGGCTGCCTGG + Intronic
1103907398 12:124334750-124334772 ACGGAGGCCCAGAGGGTGGCGGG - Intronic
1104313723 12:127677774-127677796 CTGCAGGCCCAGTGGGTGGCTGG + Intergenic
1104849289 12:131863565-131863587 CTATAGGTCCAGAGGTTGCCTGG + Intergenic
1104931173 12:132340260-132340282 CTGGACGCAGGGAGGGTGCCCGG - Intergenic
1104990503 12:132621555-132621577 CTGGGGTCCCAGCGGGTGCGGGG + Exonic
1105203092 13:18195436-18195458 AGGGAGACCCAGAGGGTTCCAGG - Intergenic
1105245603 13:18647194-18647216 CTGCAGGCCCAGAGGATTCAGGG - Intergenic
1107555390 13:41513231-41513253 CTGGAGGCCCACTCCGTGCCAGG + Intergenic
1108977252 13:56462888-56462910 CTGTAGGTCCAGAGGGAGTCAGG + Intergenic
1112415537 13:99200873-99200895 TCGGAGCCCCAGAGGGCGCCGGG - Exonic
1112579423 13:100665539-100665561 GTGGGGGCCCAGAGGCAGCCAGG - Intronic
1113150457 13:107257663-107257685 CTGGAGGCCCTGAGGTGGCCAGG + Intronic
1113521659 13:110946213-110946235 CAAGAGGCCCAGAGAGGGCCAGG + Intergenic
1113828057 13:113272226-113272248 CTGAAGGCTCAGTGGGTGGCTGG - Intergenic
1115731065 14:36270590-36270612 CTGGAGGCCCTGAGGGATCCAGG + Intergenic
1115754092 14:36516715-36516737 CTAGGCGGCCAGAGGGTGCCGGG + Exonic
1117549103 14:56816772-56816794 CTGGAGGCGCCGGGGCTGCCTGG + Intergenic
1117908398 14:60613490-60613512 CTGTGGGCCCAGAGGGTCCAGGG + Intergenic
1118346410 14:64944378-64944400 CTGGAGGCCCAGAGAGTACTAGG - Intronic
1119986877 14:79148219-79148241 CTGGAAGCTCAGAGGGTTCATGG + Intronic
1120131716 14:80815941-80815963 CTGGAGACCCAGAGGGTGGGAGG + Intronic
1122006797 14:98711959-98711981 CTAGGGCCCAAGAGGGTGCCGGG - Intronic
1122043447 14:99007071-99007093 CTCGGGGCCCAGAGGGTTCCCGG + Intergenic
1122488071 14:102094967-102094989 CAGGAGCCCCAGAGGCTCCCGGG + Intronic
1122533157 14:102443163-102443185 ATGGAGGCCCAAAGGCTGCAGGG - Intronic
1122624785 14:103078985-103079007 GGGGAGGCCCAGAGAGGGCCAGG + Intergenic
1122740374 14:103868533-103868555 CTGGGGGCCCAGAGTGGGCAGGG - Intergenic
1122782560 14:104149805-104149827 CTGGACGGGCAGAGGCTGCCTGG + Intronic
1122794667 14:104200157-104200179 CTGGAGGCCGTGGGGGTGTCTGG + Intergenic
1122797356 14:104212680-104212702 CTGGAGGCCCAGAGAGGACCCGG + Intergenic
1122860115 14:104578773-104578795 CTGGGAGCCCAGGGTGTGCCAGG - Intronic
1122938832 14:104972186-104972208 GGGGAGGCCCAGAAGGGGCCTGG - Intronic
1122967601 14:105138592-105138614 CTGCAGCCCCGGGGGGTGCCTGG - Intergenic
1123057177 14:105576023-105576045 CTGGAGGCTCAGATGGAGACGGG - Intergenic
1123081067 14:105695868-105695890 CTGGAGGCTCAGATGGAGACGGG + Intergenic
1123406254 15:20020907-20020929 CTGGAGGCTCTGAGGGAGACGGG + Intergenic
1123515584 15:21027555-21027577 CTGGAGGCTCTGAGGGAGACGGG + Intergenic
1124168387 15:27350123-27350145 CTGAAGGCCAAGATGGTGGCTGG - Intronic
1124371011 15:29104653-29104675 CTGGAGGCAGAGGGTGTGCCTGG - Intronic
1124629262 15:31327603-31327625 CTGGAGCCCGAGCGGGAGCCGGG + Exonic
1125599150 15:40906260-40906282 CTGGAGGGCCAGAGGGGGGTGGG + Intergenic
1127289169 15:57554873-57554895 CCGGAGCCCCAGAGGGAGCTTGG - Intergenic
1127699270 15:61481245-61481267 CTGGAGGCTGAGAGGGGCCCAGG + Intergenic
1128084764 15:64878103-64878125 CTGGAGGGCCAGAGGGACCCCGG + Intronic
1128453665 15:67821328-67821350 CAGGACGCCCCCAGGGTGCCGGG - Intronic
1128613936 15:69094797-69094819 CTGAAGCCCTGGAGGGTGCCTGG + Intergenic
1128646034 15:69379638-69379660 CTGGATTCCCAAAGGGAGCCTGG + Intronic
1129195777 15:73965363-73965385 CTGGAGGCAGAGGGGGAGCCGGG - Intergenic
1129249268 15:74299670-74299692 CTGGGGGACCCGATGGTGCCAGG - Intronic
1130294041 15:82630710-82630732 CTGGAGGGACAGAATGTGCCTGG + Intronic
1130334508 15:82947811-82947833 CTGGAGGCCTATTTGGTGCCAGG + Intronic
1131095651 15:89652902-89652924 CTGGAGGCTCAGAGGCTGCCAGG - Exonic
1131108692 15:89751038-89751060 CGGGGGTCCCGGAGGGTGCCTGG + Exonic
1132556971 16:576812-576834 CTGAAGGCCCAGAGGCAGCATGG - Intronic
1132595442 16:746952-746974 TTGGGGGCCCAGGGGCTGCCTGG + Intronic
1132656994 16:1045562-1045584 CTGGGGGCCCAGGGAGCGCCAGG + Intergenic
1132874192 16:2128490-2128512 CTGCAGCCGCACAGGGTGCCTGG - Intronic
1133235916 16:4387398-4387420 CTGGAGCCCCCCAGGCTGCCTGG + Intronic
1133247100 16:4456140-4456162 GTAGAGGCCCAGAGAGTCCCTGG + Exonic
1133971939 16:10574495-10574517 CTGGAGGAGCAGTGGGTGCATGG - Intronic
1134017387 16:10898605-10898627 CTGAAGGCCCACTGTGTGCCAGG - Intronic
1134553138 16:15147314-15147336 CTGCAGCCGCACAGGGTGCCTGG - Intergenic
1135325674 16:21523916-21523938 CTGGAGCCCCCGAGGGAGTCTGG + Intergenic
1136124640 16:28169091-28169113 CGTGAGGCCCTGAGGGTGCCGGG - Intronic
1136500007 16:30665334-30665356 CGGGAGGCCCGGAGGCAGCCCGG - Exonic
1137726174 16:50658210-50658232 CTGGAGTCACACAGAGTGCCAGG - Intergenic
1138022483 16:53497220-53497242 CTGGAGCCCCCGTGTGTGCCAGG + Intronic
1139581977 16:67879186-67879208 GTGGAGGCACAGAGAGGGCCAGG + Intronic
1139658871 16:68406492-68406514 CTGAAGGCCAGGATGGTGCCTGG + Intronic
1139666492 16:68460541-68460563 ATGGATGCCCAGAGGGTTACAGG + Intergenic
1139851441 16:69953176-69953198 CTAGAGGCCCGGAGGGTGCTCGG - Intronic
1139880418 16:70176088-70176110 CTAGAGGCCCGGAGGGTGCTCGG - Intronic
1139890774 16:70252027-70252049 CTGGAGGCCCGGAGGGAGAACGG + Intergenic
1140372092 16:74419429-74419451 CTAGAGGCCCGGAGGGTGCTCGG + Intronic
1140538444 16:75732941-75732963 GAGGAGTTCCAGAGGGTGCCTGG - Intronic
1140578432 16:76200061-76200083 GTTGAGGCCCTGAGGGTGTCAGG + Intergenic
1141664566 16:85459224-85459246 GTGGAGACACAGAGGGTGCCTGG - Intergenic
1141717180 16:85733759-85733781 CTGGAGTCTCAGAGGAAGCCAGG + Intronic
1141749105 16:85946467-85946489 GTGGTGGCCCAGAGGGAGCAGGG - Intergenic
1141938091 16:87255275-87255297 ATGGAGGCCCACCTGGTGCCAGG - Intronic
1142476879 17:193985-194007 CTAGAACCCCAGAGGGAGCCGGG - Intergenic
1143106101 17:4531330-4531352 CTGGGGGCCCCGAGGGCGGCGGG - Intronic
1143469458 17:7163036-7163058 ATGGAGGCCGAGAGCGCGCCTGG - Intergenic
1143562160 17:7702671-7702693 CTGGAGACCCCGAGGGAGGCAGG + Intronic
1143739995 17:8945459-8945481 CTGGTGACCCAGAGAGAGCCTGG + Intronic
1143786360 17:9258758-9258780 CTGGAGCCACAGAGGAAGCCTGG - Intronic
1144251107 17:13417637-13417659 CTGGAGCCCCAGAAGTTGCTAGG + Intergenic
1144662602 17:17080923-17080945 CTGCAGGCCCTGTGGTTGCCTGG - Intronic
1146495692 17:33319985-33320007 CTGGAGGCCCTGAGTTTGCTTGG - Intronic
1146570700 17:33950263-33950285 GTGCAGACCCAGAGGCTGCCGGG + Intronic
1146621474 17:34401845-34401867 CTGAGTGCCCAGTGGGTGCCAGG - Intergenic
1147212574 17:38880467-38880489 CTGGAGGCCAGGAGGGAGACAGG - Intronic
1147218758 17:38915847-38915869 CTGGAGGCGCTGAGCCTGCCAGG - Intronic
1147438319 17:40431497-40431519 CAGGAGCCACAGAGGGTGCTGGG + Intergenic
1147605648 17:41772386-41772408 CTGGAGTCTCTGAGGGAGCCTGG - Intronic
1147671138 17:42177594-42177616 CTGGGGGCCCAGTGGGGGCTGGG + Intronic
1148163813 17:45468412-45468434 CTTGAGTTCCAGAGGCTGCCTGG + Exonic
1148244278 17:46020396-46020418 CTGAAACCCCAGAGGGTGCTTGG - Intronic
1148340995 17:46873324-46873346 ATGGAGGCCCATAGTGAGCCAGG + Intronic
1148533753 17:48420664-48420686 CTGGAGAATCAGGGGGTGCCAGG - Intronic
1149642262 17:58210830-58210852 CTGGAAACGCAGAGGGTTCCTGG - Intronic
1149683903 17:58524322-58524344 CAGGTAGCCTAGAGGGTGCCTGG + Intronic
1149866706 17:60155060-60155082 CTGGAGGGCCAGTGGCTGCTTGG + Intronic
1150395043 17:64815066-64815088 CTTGAGTTCCAGAGGCTGCCTGG + Intergenic
1150693475 17:67384297-67384319 CTGGGGACCCTGGGGGTGCCTGG - Intronic
1151194341 17:72421026-72421048 CTGGAAGCCCAGAGTCTGGCTGG + Intergenic
1151200689 17:72465746-72465768 CGGGAGGCACAGTGGGTGACAGG - Intergenic
1151293452 17:73166285-73166307 CTGCAGGCCCTGAGGGAGGCGGG + Intronic
1152170857 17:78747204-78747226 CTGAAGGCCCAGAGTATGCCAGG + Intronic
1152192950 17:78899559-78899581 CTCTAGGCCCAGAGATTGCCAGG - Intronic
1152283518 17:79399137-79399159 CTGGAGTCTCAGAGGGGGCATGG + Intronic
1152920021 17:83061984-83062006 CAGAAGGCCCGGAGGGTGCACGG + Intergenic
1153019599 18:614864-614886 TTGGAAGCCCAGAGGTTGTCTGG + Intronic
1153748619 18:8206952-8206974 CTGGTGGCCCAGATGTTCCCTGG - Intronic
1153754080 18:8262498-8262520 CTGGAGGCCTGGAGGATGGCAGG - Intronic
1154216208 18:12418646-12418668 CAGGAGGCTCAGAGGCTTCCTGG + Intronic
1154299229 18:13178417-13178439 CTGGGACCCCAGAGGGTGCGAGG - Intergenic
1154443343 18:14412736-14412758 CTGCAGGCCCAGAGGATTCAGGG + Intergenic
1154494741 18:14947255-14947277 CTGGTGGCCCTGGGGGTGGCTGG + Intergenic
1155087290 18:22470980-22471002 CTGGAGCCCCAGAAGCTGGCTGG + Intergenic
1156994194 18:43447070-43447092 CTGGAGTCCCAGAGGGTCAGGGG - Intergenic
1157282710 18:46356675-46356697 CTGAAGGTTGAGAGGGTGCCTGG + Intronic
1157429249 18:47610989-47611011 CTGGAGGCCAAGAAGCTGACTGG - Intergenic
1157601013 18:48893306-48893328 TGGGAGCCCCAGAGGGAGCCGGG - Intergenic
1157718828 18:49907878-49907900 CTGAAGGCCCAGTGGGTGCATGG - Intronic
1158648711 18:59268740-59268762 CTGGAGGGCAACAGGCTGCCGGG - Exonic
1158706353 18:59795833-59795855 CTCCAGGCCCACAGAGTGCCCGG - Intergenic
1159018966 18:63127456-63127478 CTGGAGGGCCCCAGGGTGACAGG + Exonic
1159951332 18:74486413-74486435 CTGGTGGCCTGGAGGGAGCCTGG + Intergenic
1160073160 18:75645799-75645821 CTGGAGGGCGAGTGGGTGCTGGG + Intergenic
1160262851 18:77311429-77311451 CTGGAGCCACAGAGGCTCCCAGG + Intergenic
1160406755 18:78651693-78651715 CTGCAGGGCCAGAGGGTGTGTGG + Intergenic
1160406770 18:78651748-78651770 CTGCAGGGCCAGAGGGTGTGTGG + Intergenic
1160411553 18:78678506-78678528 CTGGAGCCCCAGAGGGGGCAGGG - Intergenic
1160521068 18:79508292-79508314 ATGGACGGACAGAGGGTGCCGGG + Intronic
1160595324 18:79969462-79969484 CTGGAGGTTCAGAGGATCCCTGG - Intronic
1160705783 19:529666-529688 CTCCAGGCCCCCAGGGTGCCGGG + Intergenic
1160753666 19:747173-747195 TAGGAGGCCCAGAGGGTGGCAGG - Exonic
1160754585 19:750909-750931 CTGGAGGCCCTGGGGGTGGAGGG + Intergenic
1160829208 19:1095112-1095134 CGGGAGGCCCAGAGGTCGCCGGG - Intronic
1160902641 19:1436394-1436416 CTGGAAGCCTACAGCGTGCCAGG + Intergenic
1160965209 19:1744441-1744463 CTGGAGGCCAGGAGGAGGCCGGG - Intergenic
1161273514 19:3403582-3403604 TTGGAGGCCCAGAGAGGGGCAGG + Intronic
1161339607 19:3734010-3734032 CTAGAGGCTCAGAGAGTGACAGG + Intronic
1161592159 19:5133758-5133780 CTGGCTGCCCACAGGGTCCCTGG - Intronic
1161961765 19:7527380-7527402 CCGCAGGCCCAGAGAGTGCCAGG + Intronic
1162183627 19:8888043-8888065 CTGGAGTCCCAGATGTTCCCAGG + Exonic
1163338644 19:16689876-16689898 TTGGAGTCCCAGACGTTGCCAGG + Exonic
1163347001 19:16749650-16749672 CTGGGGGCCCAAAGAGTACCAGG - Exonic
1163795498 19:19335505-19335527 ATAGAGCCCCAGTGGGTGCCTGG - Intronic
1163801431 19:19368083-19368105 CTGAAGGCTCAGAAAGTGCCTGG + Intergenic
1163849829 19:19656582-19656604 GTGGAGGCCCAGGGGGTGGCGGG - Intronic
1164156621 19:22601316-22601338 TTGAAGGCACAGAGGCTGCCAGG - Intergenic
1164616230 19:29668276-29668298 CTCAGGGCCCAGAGGCTGCCAGG + Intronic
1164626731 19:29734269-29734291 CTGGAAACCCAGGGGGTGGCGGG - Intergenic
1164752592 19:30667706-30667728 CTGGAAGCCCAGAGCATGTCAGG + Intronic
1165106052 19:33470213-33470235 CTGGAGGCCTAGAGGCTGGAGGG - Intronic
1165473126 19:36014768-36014790 CTGAAGGCCCAGGGGGTCCAGGG - Exonic
1166234016 19:41442841-41442863 GTGGAAGGACAGAGGGTGCCAGG + Intergenic
1166353990 19:42216613-42216635 AGGGAGGCCCAGCGGGAGCCAGG + Intronic
1166388880 19:42397765-42397787 TTGGAGGAGCAGAAGGTGCCAGG + Intergenic
1167314385 19:48755290-48755312 CTGGAGCCCCTAAGGGTGCAAGG - Exonic
1167360183 19:49025916-49025938 CAGGAAGACCAGAGGGGGCCCGG + Intronic
1167360902 19:49029865-49029887 CAGGAAGACCAGAGGGGGCCCGG - Intronic
1167362750 19:49038932-49038954 CAGGAAGACCAGAGGGGGCCCGG + Intergenic
1167363385 19:49042256-49042278 CAGGAAGACCAGAGGGGGCCCGG - Intergenic
1167365108 19:49050671-49050693 CAGGAAGACCAGAGGGGGCCCGG + Intergenic
1167429774 19:49447676-49447698 CTGGACGCCCTGAGGGGGCGGGG - Intronic
1167605805 19:50480812-50480834 CTGGAGACCCTGAGGCCGCCAGG - Intronic
1167685241 19:50951903-50951925 CTGGAGGGATAGAGGGTGCAGGG - Intronic
1168281864 19:55310218-55310240 CTGCAGGCTAACAGGGTGCCTGG + Intronic
1168320748 19:55508119-55508141 CTGGAGGTCCAGGGAGCGCCTGG + Intronic
925977283 2:9150141-9150163 CTGGAGGCCAAGAAGGGGGCTGG + Intergenic
926322995 2:11762038-11762060 CAGGAGGCCCAGACTGTGACTGG - Intronic
927139152 2:20118075-20118097 CTGGAGGAGCAGGGGGAGCCCGG + Intergenic
929667491 2:43844493-43844515 CTGGAGGCCCTGTGGGAGACAGG - Exonic
930020797 2:47000977-47000999 CTGGAGGCACAGAAGGAGCCAGG + Intronic
930096527 2:47570542-47570564 CCCGTGGCCCAGCGGGTGCCCGG + Exonic
932141973 2:69287055-69287077 CCAGAGGCACAGAGGGTTCCTGG + Intergenic
932355431 2:71064607-71064629 CTGGAGTCACGGAGGGAGCCAGG - Intronic
932447688 2:71790868-71790890 CTGCAGGCAGAGAGGCTGCCAGG - Intergenic
932555157 2:72817525-72817547 CTGGGAACCCAAAGGGTGCCTGG - Intronic
933762313 2:85680786-85680808 CTGGAGGCCCCAAGGCAGCCAGG - Intergenic
934508246 2:94914084-94914106 CTGGAGAGACAGAGGGTGCATGG - Intergenic
934813729 2:97306348-97306370 CTGGAGGCACACAGAGTACCAGG - Intergenic
934823966 2:97402132-97402154 CTGGAGGCACACAGAGTACCAGG + Intergenic
935111498 2:100098743-100098765 CTGGGGCCCCAGAGGATACCAGG - Intronic
935217828 2:100988729-100988751 CTGGAGGAGCAGGGGGCGCCTGG - Intronic
935217835 2:100988748-100988770 CTGGAGGAGCAGTGGGGGCCTGG - Intronic
935217866 2:100988840-100988862 CTGGAGGAGCAGTGGGGGCCTGG - Intronic
935217877 2:100988877-100988899 CTGGAGGGGCAGGGGGCGCCTGG - Intronic
935217886 2:100988896-100988918 CTGGAGGAACAGTGGGGGCCTGG - Intronic
935217906 2:100988951-100988973 CTGGAGGAGCAGGGGGCGCCTGG - Intronic
935217921 2:100988988-100989010 CTGGAGGAGCAGTGGGGGCCTGG - Intronic
935349011 2:102137572-102137594 CTTGATGCCCAGAGCTTGCCAGG - Intronic
936059698 2:109286398-109286420 CTGGAGGCCCAGAGGGGCAAAGG + Intronic
936069253 2:109354289-109354311 CTGCAGGCCCAGAGGCTGAAGGG + Intronic
936123470 2:109766421-109766443 CTGGGGCCCCAGAGGATACCAGG + Intergenic
936221215 2:110605043-110605065 CTGGGGCCCCAGAGGATACCAGG - Intergenic
936242877 2:110803160-110803182 CTGGTGGTCCTGAGGGGGCCTGG - Intronic
936462475 2:112723228-112723250 CTGGAGGCCTGAAGGCTGCCCGG - Intronic
937258932 2:120573126-120573148 CTGGAGCCCCTGAGCCTGCCTGG + Intergenic
937435937 2:121881338-121881360 ATGTGTGCCCAGAGGGTGCCAGG + Intergenic
938565164 2:132512407-132512429 TTGGAGGCCATTAGGGTGCCAGG - Intronic
939100788 2:137892312-137892334 CTGCAGGCCCAGAGGATGCAGGG - Intergenic
939696786 2:145335698-145335720 CTGGAGGCCGTGTGGGTGCTAGG + Intergenic
941055499 2:160783396-160783418 CTGCAGGCCCAGAGGGTTTAGGG - Intergenic
942278529 2:174340298-174340320 CTGGAGGCCCAGAGGGTGCCTGG + Intergenic
943750020 2:191501272-191501294 TGGGAGGCCCATAGGCTGCCAGG + Intergenic
944168678 2:196750809-196750831 CTGGTGGCCCAGACTGAGCCAGG - Intronic
946163000 2:217847509-217847531 CTGGTGGCCCACAGGGTAGCAGG - Exonic
946182062 2:217954803-217954825 CAGGAAGCCCACAGGGGGCCTGG - Intronic
946337187 2:219045766-219045788 CTGGAAGCCCACATTGTGCCAGG + Intergenic
948205280 2:236160009-236160031 CTCGAGGCCCACGGGGTGCACGG + Intergenic
948668904 2:239553836-239553858 CTGGAGGTGCAGAGGGGCCCGGG - Intergenic
948711542 2:239828602-239828624 CTGGAAGCCCAGGGGTTGTCTGG - Intergenic
948808539 2:240463296-240463318 CCCGAGGCCCTGGGGGTGCCTGG - Intronic
948858122 2:240740134-240740156 CTGGATGCCCTGCCGGTGCCAGG + Exonic
948957268 2:241303271-241303293 CAGGAGCCCCAGATGGTGCAGGG + Intronic
1169191687 20:3662163-3662185 CTGGAGACAGAGAAGGTGCCTGG + Intronic
1169200211 20:3705613-3705635 CTGGAGGCCCAGGAGCAGCCTGG + Intronic
1169318230 20:4610597-4610619 CTGGAGGAGCAGTGGGTGCAGGG - Intergenic
1169327471 20:4687030-4687052 CGCGATGCCCAGAGGGTGCTTGG + Intronic
1169465446 20:5834168-5834190 CTGGAGGCCGGGAGGGTGTCAGG + Intronic
1170038694 20:12017717-12017739 CTGGAGGCCAAGCAGGTGCCTGG + Intergenic
1170533247 20:17315441-17315463 CTGGAGGGCCAGAGAGTGATCGG - Intronic
1170573335 20:17645055-17645077 CTGTAGGACCAGGGGCTGCCAGG - Intronic
1170575910 20:17661354-17661376 TGGGAGGCCCAGAAGATGCCAGG + Intronic
1170883461 20:20317851-20317873 CTGGAGGCCGTGAGGCTGCTGGG + Intronic
1170889129 20:20364448-20364470 CGGGAGGCCCGGAAGGTGCCTGG + Intergenic
1171163126 20:22946634-22946656 CTGGAGTCACAGAGGCTGGCTGG + Intergenic
1173159823 20:40644174-40644196 CTGGAGGCCCCTAGCATGCCAGG - Intergenic
1174153100 20:48499987-48500009 CTGGAGACCCAGGGGGTAGCCGG - Intergenic
1174177995 20:48657060-48657082 CAGGAGGCGCAGAGGGCGGCGGG + Exonic
1174386168 20:50189827-50189849 GTGGAGGCCCAGAGAGAGCATGG - Intergenic
1174390716 20:50216831-50216853 CTGGGGGCCATGAGGGTGCCTGG + Intergenic
1174407323 20:50310673-50310695 CTGGGGGCCCAGCGGCAGCCAGG + Intergenic
1174918057 20:54673996-54674018 TTGGATGCCTAGAGTGTGCCTGG + Intergenic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1176056528 20:63151834-63151856 CTGGAGAGCCAGAGGGAGCCGGG + Intergenic
1176452749 21:6878472-6878494 CTGCAGGCCCAGAGGATTCAGGG - Intergenic
1176682137 21:9824973-9824995 CCGGAGCCTCAGGGGGTGCCTGG - Intergenic
1176682416 21:9826382-9826404 CCGGAGCCTCAGGGGGTGCCTGG - Intergenic
1176682694 21:9827801-9827823 CCGGAGCCTCAGGGGGTGCCTGG - Intergenic
1176682974 21:9829198-9829220 CCGGAGCCTCAGGGGGTGCCTGG - Intergenic
1176683254 21:9830608-9830630 CCGGAGCCTCAGGGGGTGCCTGG - Intergenic
1176683533 21:9832017-9832039 CCGGAGCCTCAGGGGGTGCCTGG - Intergenic
1176683813 21:9833420-9833442 CCGGAGCCTCAGGGGGTGCCTGG - Intergenic
1176684090 21:9834829-9834851 CCGGAGCCTCAGGGGGTGCCTGG - Intergenic
1176684370 21:9836230-9836252 CCGGAGCCTCAGGGGGTGCCTGG - Intergenic
1176714868 21:10342569-10342591 AGGGAGACCCAGAGGGTTCCAGG + Intergenic
1176830922 21:13743521-13743543 CTGCAGGCCCAGAGGATTCAGGG - Intergenic
1176878021 21:14153644-14153666 CTGAAGTCCCAGAGGGGTCCAGG - Intronic
1178485954 21:33020280-33020302 CTGCAGGCCCCCAGGGAGCCCGG + Intergenic
1179284273 21:39963242-39963264 CTGAGGACCCAGAGGATGCCAGG - Intergenic
1179419390 21:41223432-41223454 CTGGAGTCTCAGAGGATGCATGG - Intronic
1179639098 21:42735506-42735528 CTGGAGGCTCTGAGGGGCCCTGG + Intronic
1180079542 21:45480506-45480528 CTGGAGGCCCTGCGGGTGAGTGG + Exonic
1180603480 22:17037369-17037391 AGGGAGACCCAGAGGGTTCCAGG - Intergenic
1180784323 22:18538502-18538524 CTGGCGGCCCAGCTGGTCCCGGG + Intergenic
1180945170 22:19688651-19688673 GCAGAGGCCCAGAGGCTGCCGGG + Intergenic
1181001660 22:19990585-19990607 CTGGAGGACCAGCTGTTGCCAGG + Exonic
1181068369 22:20317174-20317196 CTGTAGGCACAGCGGGAGCCAGG - Intronic
1181127898 22:20712555-20712577 CTGGCGGCCCAGCTGGTCCCGGG + Exonic
1181164161 22:20974511-20974533 CTGTAGGGCCTGTGGGTGCCAGG - Exonic
1181241226 22:21477859-21477881 CTGGCGGCCCAGCTGGTCCCGGG + Intergenic
1181522944 22:23459885-23459907 CTGGGGGCCCAGGGGGCGTCTGG - Intergenic
1181982533 22:26775604-26775626 CAGGAGAGCCAGAGGGTGCCAGG + Intergenic
1182284008 22:29233428-29233450 CTGGAGGCCCAGTGGGTCCCTGG - Exonic
1182354334 22:29715588-29715610 GTGGAGGCCCAGAGGACGCCAGG + Intergenic
1183323146 22:37177309-37177331 CTGGAGGACTGGAGGGTGCTGGG - Intergenic
1184083216 22:42240639-42240661 GTGGAGGCCCAGAAAGTGCCTGG + Intronic
1184172677 22:42769065-42769087 CTGCAGGCCCACTGTGTGCCGGG + Intergenic
1184391605 22:44206469-44206491 CTGGAGGGCCCGAGGCTGCAGGG + Exonic
1184451364 22:44584631-44584653 CAGCAAGCCCAGAGGCTGCCTGG + Intergenic
1184583855 22:45434643-45434665 CAAGAGGCCCAGTGGGAGCCTGG - Intergenic
1184757062 22:46522790-46522812 TCGGAGGTCCAGAGGGGGCCAGG + Intronic
1184803069 22:46774296-46774318 CAGGAGGCCCAGAGGGAACAGGG + Intronic
1185005191 22:48271723-48271745 GTGGAGGCTGAGAGGCTGCCAGG + Intergenic
1185007316 22:48288739-48288761 CAGGAGGCCCTGAGGACGCCCGG - Intergenic
1185081156 22:48710097-48710119 CTGAAGACCCCGATGGTGCCTGG - Intronic
1185139906 22:49094307-49094329 CTGGCAGCCCAGAGCGTGCCCGG - Intergenic
1185373368 22:50470948-50470970 CTGGAGGCCAAGATGTGGCCTGG - Intronic
953350177 3:42209638-42209660 CTGGAGGCCCAGACCCTGCTGGG + Intronic
953649288 3:44785863-44785885 GTGGAGGCCTCTAGGGTGCCTGG + Intronic
953753752 3:45629704-45629726 CTGGATGGCGAGAGGATGCCAGG + Intronic
954623296 3:52007805-52007827 CCACAGGCCCACAGGGTGCCGGG + Intergenic
954707162 3:52487212-52487234 CCGGAGGTCCAGGTGGTGCCGGG + Exonic
954798618 3:53174403-53174425 CTGCAGGGCCAGGGGGTGCCGGG - Intronic
955317597 3:57951799-57951821 CTGGAGGGGCAGAGGCAGCCTGG - Intergenic
960619077 3:119621894-119621916 CTGGAGGCCCCAAGGGAGCTAGG - Intronic
961468625 3:127097349-127097371 CTGGAGGACCAGGGGGTTGCAGG - Intergenic
961616541 3:128187193-128187215 CTGGAGGCAGTCAGGGTGCCCGG - Intronic
961633890 3:128321074-128321096 TGGGAGGCCCTGGGGGTGCCAGG + Intronic
961649157 3:128408830-128408852 CTGAAGGCCCAGAGCGCCCCAGG - Intergenic
962670977 3:137708390-137708412 ATGGAGGCCCACAGAGTCCCAGG + Intergenic
963906778 3:150779451-150779473 CTGGAGGGGCCGAGGGTGGCTGG + Intergenic
964356217 3:155854188-155854210 CTAGAGGCCCAGAGGATGCCTGG + Exonic
968467941 4:762356-762378 CTGGTGGCCCAGGGGCTCCCTGG - Intronic
968577393 4:1374292-1374314 CAGGAGGCACAGGAGGTGCCAGG - Intronic
968628180 4:1637417-1637439 CTCGAGGGACAGAGGGAGCCTGG + Intronic
968661962 4:1802354-1802376 TCTGAGGCCCAGAGGGGGCCTGG - Intronic
969347484 4:6578521-6578543 CTGGAGGTCCTGAGGGACCCTGG - Intronic
969429772 4:7147385-7147407 CTGGAAGCTCAGTGGGTGCAGGG + Intergenic
971195630 4:24470504-24470526 ATCGGGGCCCGGAGGGTGCCCGG - Intergenic
971500558 4:27313860-27313882 CGGGAGGCCCAGGTGCTGCCTGG - Intergenic
972245538 4:37243299-37243321 GTGCAGGCCCAGAGGAGGCCGGG + Intergenic
975832685 4:78386513-78386535 CAGGAGGCCAGGAGGGTGCTTGG + Intronic
978682797 4:111402669-111402691 CTGGATGACAAGAGGGTGACTGG + Intergenic
978903852 4:113983615-113983637 CTGGATGCCCAGAGGTTGGAGGG + Intergenic
979438881 4:120727540-120727562 CTTGAGGCCCACTGAGTGCCTGG - Intronic
983537850 4:168877719-168877741 CTGGAGCTTCAGAGGGTCCCTGG - Intronic
985233608 4:187848957-187848979 CTGGAGGCTCAGAGAGGGGCAGG - Intergenic
985575394 5:671325-671347 CTTGGGGCCCAGAGGGACCCCGG + Intronic
985994992 5:3592809-3592831 CTGGTGGCCCTAGGGGTGCCAGG - Intergenic
986199630 5:5569494-5569516 CTGGGGGTGCAGAGAGTGCCAGG - Intergenic
986988202 5:13522630-13522652 ACTGAGGCCCAGAGGGAGCCAGG - Intergenic
987193277 5:15500470-15500492 CTGGAGCCACCGGGGGTGCCAGG + Exonic
988065697 5:26227422-26227444 CTGGAGACCCAGAGGGGAGCTGG - Intergenic
989523259 5:42424738-42424760 CTGGCGGCGCAGAGGGTGCGGGG + Intronic
993307748 5:86291918-86291940 CTGGAGCCCCTGGGGCTGCCTGG + Intergenic
993646880 5:90473875-90473897 CTGGAGGGCCAGACAGTTCCGGG - Exonic
994471329 5:100211770-100211792 CTGTAGGCCCAGTGGGTACAGGG - Intergenic
994685494 5:102946194-102946216 CTGGAGGCCAACAGGGGTCCTGG - Intronic
996352455 5:122560615-122560637 CTGGAGCCCCACATGGTGCAGGG - Intergenic
997471456 5:134119682-134119704 CGGCAGGTCCAGAGCGTGCCTGG + Intronic
997817746 5:137034918-137034940 CGGGCGGCCCAGAGGGGTCCAGG + Intronic
999244261 5:150144894-150144916 TTGGAGGCCCAGATGGGGCCGGG - Intronic
999262277 5:150245381-150245403 TTGGAGGCCCAGGGACTGCCTGG + Intronic
1000834317 5:166135422-166135444 CTGGAGGCCCAGATGCTGGGAGG + Intergenic
1001085652 5:168698517-168698539 CTAGAGGCTCAGAGGGAGCATGG + Intronic
1001304251 5:170560202-170560224 CTGGAAGCCCAGAGGCTGAGAGG - Intronic
1001636125 5:173211551-173211573 CTGGAGGCTGAGAAGGGGCCGGG + Intergenic
1001652787 5:173327670-173327692 CGGGAGGCCCAGAGGGTCCCCGG - Intronic
1001971162 5:175956153-175956175 CTGCACGCCCACAGTGTGCCAGG + Intronic
1002246280 5:177887624-177887646 CTGCACGCCCACAGTGTGCCAGG - Intergenic
1002603605 5:180369398-180369420 CTGGTGGCCCTGAAGGTTCCAGG + Intergenic
1003338229 6:5195196-5195218 CTAGAGACCTGGAGGGTGCCAGG + Intronic
1004464029 6:15866776-15866798 CTGGAGCCTCAGAGGGTGTTGGG - Intergenic
1005048789 6:21665606-21665628 CTGTAGGGTCAGAGGGCGCCTGG + Intergenic
1005126399 6:22451228-22451250 CTAGAAGCCCAGTGGATGCCAGG - Intergenic
1006406718 6:33849829-33849851 CAGGAGGCCTGGAAGGTGCCGGG - Intergenic
1006581107 6:35078490-35078512 CTGGTGGCCCTGAGGGGGTCAGG - Intronic
1007297609 6:40838358-40838380 GTGGGGGCCCACAGAGTGCCTGG - Intergenic
1007485162 6:42175821-42175843 CTGGGGGCAGAGAGGGTCCCAGG - Intronic
1007679741 6:43625915-43625937 CTGTAGGTCCAGAGCGAGCCTGG - Intronic
1007680310 6:43629105-43629127 CTGCCGGCCCGGAGGGGGCCCGG - Exonic
1007830814 6:44637001-44637023 CTGCAGGCACAGAGGATGGCAGG - Intergenic
1008109429 6:47477343-47477365 AGGGAGGCCCAGATGCTGCCAGG - Intergenic
1012421873 6:99074691-99074713 CAGGAGGCTCAGAGGATACCGGG + Intergenic
1014635598 6:123843084-123843106 CTGGAGCCCCAGAGGGTGTGTGG + Intronic
1015680979 6:135808138-135808160 CTGGAGAGACAGAGGGTGACTGG - Intergenic
1015923907 6:138291362-138291384 ATGGAGGGAAAGAGGGTGCCTGG + Intronic
1017254758 6:152320923-152320945 GTGAATGCCCAGAGTGTGCCAGG - Intronic
1017603142 6:156105093-156105115 CTGGAGGTCCACAGGGTGTTAGG + Intergenic
1018178044 6:161196016-161196038 CTAGAGCCCCTGAAGGTGCCAGG + Intronic
1018306939 6:162467772-162467794 CTGGAGGACAAGTGGGAGCCAGG - Intronic
1018433937 6:163744515-163744537 CTGCAGGTCCTGAGGATGCCCGG + Intergenic
1019061842 6:169262818-169262840 CAGGAGGCTCGGAGGGGGCCTGG - Intergenic
1019061896 6:169262987-169263009 CAGGAGGCTCGGAGGGGGCCTGG - Intergenic
1019061930 6:169263100-169263122 CAGGAGGCTCGGAGGGGGCCTGG - Intergenic
1019147909 6:169986640-169986662 GTGCAGGCCGAGAGGGTGGCAGG - Intergenic
1019275823 7:175117-175139 CATGAGGCCCACAGAGTGCCTGG - Intergenic
1019299518 7:296266-296288 CAGGAGGACCAGGAGGTGCCAGG - Intergenic
1019299557 7:296377-296399 CTGGGGGTCCAGAAGGGGCCTGG - Intergenic
1019301576 7:306835-306857 CTGGGGGAGCTGAGGGTGCCCGG - Intergenic
1019302255 7:311789-311811 CTGGGGGAGCTGAGGGTGCCCGG + Intergenic
1019421410 7:952961-952983 TGGGAGGCCCAGAGGGTGGCTGG + Intronic
1019424025 7:964725-964747 CTGGAGGCCCAGAGCCCCCCAGG - Intronic
1019522720 7:1467970-1467992 CAAGAGGCCCAGAGGGTCCCAGG + Intergenic
1019588384 7:1816666-1816688 CTGGGGGCCCAGGGGGAGTCTGG + Intronic
1020098436 7:5381129-5381151 CTTGAGGCCCTGAGGGTGGCAGG - Intronic
1021202343 7:17741148-17741170 CTGGAGGACCAGAGGGGCCAGGG - Intergenic
1022096468 7:27144610-27144632 CTGCAGCCACAGAGGCTGCCTGG + Intronic
1023834832 7:44062025-44062047 CCGGATGCTCAGTGGGTGCCAGG - Intronic
1023909186 7:44541587-44541609 CTGGAGGCACAGATGGGACCAGG + Intergenic
1023999788 7:45182804-45182826 CTCCAGGGCCAAAGGGTGCCTGG - Intronic
1024338931 7:48237641-48237663 CAGCAGGCCCAGAGAGTGACAGG - Intronic
1024711666 7:52021869-52021891 CAGGAGGCCTAGAGGGAGCAAGG - Intergenic
1024919850 7:54545189-54545211 CTGCGGTCCCAGATGGTGCCTGG - Intronic
1026433195 7:70368696-70368718 CAGGAGGCCAAGAAAGTGCCTGG + Intronic
1026590162 7:71687441-71687463 CTGGAAGCCAAGAGGCTGCTGGG - Intronic
1026848209 7:73709290-73709312 CTGGAGGACCACTGGGGGCCCGG + Intronic
1032425141 7:131816537-131816559 CTGGAGGCCTAATTGGTGCCAGG - Intergenic
1033543774 7:142381375-142381397 TTGGAAGCCCAATGGGTGCCGGG + Intergenic
1034098924 7:148435482-148435504 AGGGAGGCAGAGAGGGTGCCTGG - Intergenic
1034254590 7:149717627-149717649 CCGGAGGCCCAGAGGCTGATGGG - Intronic
1034264901 7:149776145-149776167 CTGATGCCCCAGAGGGTCCCTGG - Intergenic
1034760260 7:153665772-153665794 CTGGAGGCTCGGAAGGAGCCGGG + Intergenic
1035018536 7:155787317-155787339 CTGGCTGCCCCGAGGGTCCCAGG + Intergenic
1035531579 8:356398-356420 CTAGAGGCACAGAGGCTACCTGG + Intergenic
1035568611 8:658311-658333 CGGGAGGCCCAGTGGAGGCCAGG - Intronic
1036041543 8:5087789-5087811 CGAGAGGACAAGAGGGTGCCAGG + Intergenic
1036448887 8:8847696-8847718 CTGAAGGTCCAGAGTGTGCAGGG - Intronic
1036668476 8:10764093-10764115 ATGGAGGCCTTGAGGCTGCCTGG - Intronic
1036785360 8:11681863-11681885 CTGAAGGCGCAGAGTATGCCAGG - Intronic
1037915436 8:22770124-22770146 GTGGAAGCCCACAGGGTACCAGG + Intronic
1037937877 8:22927538-22927560 CGGGAGGCACAGAGGCTACCAGG - Intronic
1038402681 8:27297395-27297417 CTGGAGGAAGAGAGGGTGCCAGG + Intronic
1039954255 8:42195146-42195168 CTGGAGGCACAGGGGCTTCCAGG + Intronic
1040538079 8:48327027-48327049 CTGGGGACACAGAGGTTGCCTGG - Intergenic
1041181076 8:55248808-55248830 CTGGAGTCTCAGAGTGTCCCAGG + Intronic
1043511068 8:80950647-80950669 CTGGAGGCCAGGAGGGCGGCAGG + Intergenic
1045489705 8:102658795-102658817 CTGGAGGTGCAGAGGGTGTCAGG + Intergenic
1047335960 8:123936556-123936578 CTGGAGGACCAGAAAATGCCAGG - Intronic
1047498015 8:125422360-125422382 CTGGAGGACCAGCGAGGGCCTGG - Intergenic
1048220013 8:132532531-132532553 CTGGAAGCCCGGAGGGTGAGAGG + Intergenic
1048329143 8:133460494-133460516 CTAGTGGCCCTGAGGGCGCCTGG - Intronic
1048809004 8:138268214-138268236 TTGTATGCCCAGAGCGTGCCTGG - Intronic
1049187391 8:141264410-141264432 CGGGAGGCAGAGAGGCTGCCGGG + Intronic
1049268648 8:141682705-141682727 CAGGAGGCCCAGAGGGAGACAGG + Intergenic
1049300545 8:141867242-141867264 GTTGTGGCCCAGAGGGGGCCAGG + Intergenic
1049381498 8:142318635-142318657 CTGGGGGCCGAGAAGGAGCCAGG + Intronic
1049588193 8:143441470-143441492 CTGGCAGCACAGAGGGAGCCCGG + Intronic
1049594587 8:143477534-143477556 CTGCAGGCCCAGCAGGTGCATGG + Intronic
1049692118 8:143966020-143966042 CAGGAGGCCCTGCTGGTGCCAGG - Intronic
1050574355 9:6977659-6977681 CTGGAGGCCCAGCAGATGACAGG - Intronic
1050982476 9:12037354-12037376 CTGGAGTACCAGAGGGAGACAGG + Intergenic
1052158563 9:25226411-25226433 CTGGAGTCCCAAAGGGTGGAGGG + Intergenic
1052861512 9:33440671-33440693 CTGGAGGCAGGGAGGCTGCCAGG + Intergenic
1057392709 9:94652901-94652923 CTGGGGGGCCAGATGGTGCAGGG - Intergenic
1057489587 9:95510924-95510946 CTGGAGGCCCGGAGCCGGCCCGG - Intronic
1057804268 9:98209381-98209403 CTGGGGGCCTAGATAGTGCCTGG + Intronic
1060042111 9:120308694-120308716 CAGGAGGCCTAGAGGGAACCAGG - Intergenic
1060269688 9:122131853-122131875 CAGGAAGCCCAGCGGGTGGCCGG - Intergenic
1060406656 9:123376219-123376241 CTGGAGGTACAGAGGGAGGCTGG + Intronic
1060558355 9:124521866-124521888 CTGGGGGCCCCGAGGGAGCTGGG + Exonic
1060940111 9:127538283-127538305 CTGGATCCCCAGAGTTTGCCAGG + Intronic
1061044035 9:128154665-128154687 CAGCAGGCCCAGGGGGTGACAGG - Intergenic
1061059931 9:128245188-128245210 CGGGAGCCCCAGAGGGCGGCTGG - Intronic
1061322600 9:129840402-129840424 CTGGAGGCTCAGTGGGTGCTGGG + Intronic
1061412366 9:130428525-130428547 CTGGAAACCCAGAGGTTGCCAGG + Intronic
1061925031 9:133801822-133801844 CTGGAGGCCCCGGGTGTTCCTGG - Intronic
1062150612 9:135016930-135016952 CTGGGGGCCCAGATTGTGCAGGG + Intergenic
1062235094 9:135504059-135504081 CTGCAGGGCCAGAAGGAGCCCGG + Exonic
1062331906 9:136048637-136048659 CTGCAGGCGGAGAGGGAGCCAGG + Intronic
1062436951 9:136550603-136550625 CAGGAGGCCCAGTGCCTGCCCGG - Intergenic
1062450863 9:136615140-136615162 CTGGGGTCCCAGATGCTGCCCGG + Intergenic
1062468387 9:136691556-136691578 ACGGAGGCCCAGAGGGTGCCTGG + Intergenic
1062480477 9:136748590-136748612 CAGGAGGCCAGGAGGGTTCCTGG - Intergenic
1062521946 9:136961601-136961623 CAGCAGGCCCAGATGGTGGCCGG - Intergenic
1062696843 9:137879985-137880007 GTGGGGGCCCAGGGGGTGCGGGG + Intronic
1203516432 Un_GL000213v1:6043-6065 CTGCAGGCCCAGAGGATTCAGGG + Intergenic
1187504532 X:19868036-19868058 CTGGAGGGCCAGAGGGTATTAGG + Intronic
1189336140 X:40171998-40172020 CCCCAGGCCCAGAGGGGGCCAGG - Intronic
1189361076 X:40351929-40351951 CTGCAGGCCCAGAGGGTTTGGGG + Intergenic
1190159735 X:48022572-48022594 CTGGAACCCCAAAGGGAGCCAGG + Intronic
1190263425 X:48813958-48813980 CTGGAGGCCCAAATGGAGCATGG - Intronic
1190334969 X:49256856-49256878 CTGGGGGGACAGAGGGTGTCAGG + Intronic
1191914600 X:66188048-66188070 CTTGAAGACCAGAGGGTGGCAGG + Intronic
1192427016 X:71086210-71086232 CTGGAGCCCCAGAAGGTTACAGG + Intergenic
1198180118 X:134199262-134199284 CTGTAGTCCCAGATGGTGGCGGG - Intergenic
1198242768 X:134801502-134801524 CTGGAGGGCCAAAGGGTCCCTGG - Intronic
1199977700 X:152904126-152904148 CTGGAGGCCAACAGGGTGGCAGG - Intergenic
1200150570 X:153949436-153949458 CTGGAGGCCCTGCTGGTGCAGGG + Intronic