ID: 942282741

View in Genome Browser
Species Human (GRCh38)
Location 2:174383221-174383243
Sequence AGTGGCTGCTCAGTGCTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942282739_942282741 14 Left 942282739 2:174383184-174383206 CCAGAATAGGTAAATCTATAGAG 0: 15
1: 244
2: 956
3: 1970
4: 2462
Right 942282741 2:174383221-174383243 AGTGGCTGCTCAGTGCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942282741 Original CRISPR AGTGGCTGCTCAGTGCTGAG AGG Intronic
No off target data available for this crispr