ID: 942291672

View in Genome Browser
Species Human (GRCh38)
Location 2:174478508-174478530
Sequence CTAAAAAAGAAGGCTGGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942291672_942291675 4 Left 942291672 2:174478508-174478530 CCATGTCCAGCCTTCTTTTTTAG No data
Right 942291675 2:174478535-174478557 AACATGCACTATTCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942291672 Original CRISPR CTAAAAAAGAAGGCTGGACA TGG (reversed) Intronic
No off target data available for this crispr