ID: 942293052

View in Genome Browser
Species Human (GRCh38)
Location 2:174490678-174490700
Sequence CAGCGGGACTTGAGGGAAAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942293052_942293060 28 Left 942293052 2:174490678-174490700 CCGATTTCCCTCAAGTCCCGCTG No data
Right 942293060 2:174490729-174490751 ATGGTTTGATACAATGACAAAGG No data
942293052_942293055 -8 Left 942293052 2:174490678-174490700 CCGATTTCCCTCAAGTCCCGCTG No data
Right 942293055 2:174490693-174490715 TCCCGCTGATCAAAATTGACAGG No data
942293052_942293058 9 Left 942293052 2:174490678-174490700 CCGATTTCCCTCAAGTCCCGCTG No data
Right 942293058 2:174490710-174490732 GACAGGAGAAACAAACCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942293052 Original CRISPR CAGCGGGACTTGAGGGAAAT CGG (reversed) Intergenic
No off target data available for this crispr