ID: 942293060

View in Genome Browser
Species Human (GRCh38)
Location 2:174490729-174490751
Sequence ATGGTTTGATACAATGACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942293054_942293060 20 Left 942293054 2:174490686-174490708 CCTCAAGTCCCGCTGATCAAAAT No data
Right 942293060 2:174490729-174490751 ATGGTTTGATACAATGACAAAGG No data
942293056_942293060 12 Left 942293056 2:174490694-174490716 CCCGCTGATCAAAATTGACAGGA No data
Right 942293060 2:174490729-174490751 ATGGTTTGATACAATGACAAAGG No data
942293052_942293060 28 Left 942293052 2:174490678-174490700 CCGATTTCCCTCAAGTCCCGCTG No data
Right 942293060 2:174490729-174490751 ATGGTTTGATACAATGACAAAGG No data
942293053_942293060 21 Left 942293053 2:174490685-174490707 CCCTCAAGTCCCGCTGATCAAAA No data
Right 942293060 2:174490729-174490751 ATGGTTTGATACAATGACAAAGG No data
942293057_942293060 11 Left 942293057 2:174490695-174490717 CCGCTGATCAAAATTGACAGGAG No data
Right 942293060 2:174490729-174490751 ATGGTTTGATACAATGACAAAGG No data
942293051_942293060 29 Left 942293051 2:174490677-174490699 CCCGATTTCCCTCAAGTCCCGCT No data
Right 942293060 2:174490729-174490751 ATGGTTTGATACAATGACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942293060 Original CRISPR ATGGTTTGATACAATGACAA AGG Intergenic
No off target data available for this crispr