ID: 942294956 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:174508136-174508158 |
| Sequence | CCTTGGGCCTTGAGTGAACA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 942294951_942294956 | -3 | Left | 942294951 | 2:174508116-174508138 | CCACAAGCTGACTGAAGAGCCCT | 0: 98 1: 260 2: 438 3: 438 4: 600 |
||
| Right | 942294956 | 2:174508136-174508158 | CCTTGGGCCTTGAGTGAACATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 942294956 | Original CRISPR | CCTTGGGCCTTGAGTGAACA TGG | Intergenic | ||
| No off target data available for this crispr | |||||