ID: 942294956

View in Genome Browser
Species Human (GRCh38)
Location 2:174508136-174508158
Sequence CCTTGGGCCTTGAGTGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942294951_942294956 -3 Left 942294951 2:174508116-174508138 CCACAAGCTGACTGAAGAGCCCT 0: 98
1: 260
2: 438
3: 438
4: 600
Right 942294956 2:174508136-174508158 CCTTGGGCCTTGAGTGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942294956 Original CRISPR CCTTGGGCCTTGAGTGAACA TGG Intergenic
No off target data available for this crispr