ID: 942296803

View in Genome Browser
Species Human (GRCh38)
Location 2:174525349-174525371
Sequence GAGTATCACATTGACCAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942296796_942296803 17 Left 942296796 2:174525309-174525331 CCTCATGGTCTAACCACCTCTTA No data
Right 942296803 2:174525349-174525371 GAGTATCACATTGACCAACAAGG No data
942296797_942296803 4 Left 942296797 2:174525322-174525344 CCACCTCTTAAAAACCCCACCTC No data
Right 942296803 2:174525349-174525371 GAGTATCACATTGACCAACAAGG No data
942296798_942296803 1 Left 942296798 2:174525325-174525347 CCTCTTAAAAACCCCACCTCTTA No data
Right 942296803 2:174525349-174525371 GAGTATCACATTGACCAACAAGG No data
942296795_942296803 18 Left 942296795 2:174525308-174525330 CCCTCATGGTCTAACCACCTCTT No data
Right 942296803 2:174525349-174525371 GAGTATCACATTGACCAACAAGG No data
942296799_942296803 -10 Left 942296799 2:174525336-174525358 CCCCACCTCTTAAGAGTATCACA No data
Right 942296803 2:174525349-174525371 GAGTATCACATTGACCAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942296803 Original CRISPR GAGTATCACATTGACCAACA AGG Intergenic
No off target data available for this crispr