ID: 942298593

View in Genome Browser
Species Human (GRCh38)
Location 2:174540489-174540511
Sequence AGTTATGCTTAGGACCTCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942298590_942298593 12 Left 942298590 2:174540454-174540476 CCGTCTCACCAAAAAAAAAAAAA 0: 130
1: 1132
2: 92631
3: 92181
4: 140466
Right 942298593 2:174540489-174540511 AGTTATGCTTAGGACCTCATTGG No data
942298591_942298593 4 Left 942298591 2:174540462-174540484 CCAAAAAAAAAAAAAAAAAAAAA 0: 12750
1: 14510
2: 25740
3: 52715
4: 189344
Right 942298593 2:174540489-174540511 AGTTATGCTTAGGACCTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942298593 Original CRISPR AGTTATGCTTAGGACCTCAT TGG Intergenic
No off target data available for this crispr