ID: 942300794

View in Genome Browser
Species Human (GRCh38)
Location 2:174560106-174560128
Sequence CACATGTAAGCTCTGATTTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 153}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942300794 Original CRISPR CACATGTAAGCTCTGATTTC AGG Exonic
901135795 1:6994278-6994300 CAAATGGGAACTCTGATTTCAGG - Intronic
902185110 1:14719104-14719126 CACATGTACTCTCTGCTTGCTGG + Intronic
902806268 1:18863190-18863212 CACATGTCAGTTCTGAATTGGGG + Intronic
903560198 1:24221338-24221360 CACATGTCAACTCTGATCTGTGG + Intergenic
903636404 1:24820539-24820561 CACATGTAAGCTGTCATGACTGG + Intronic
905172306 1:36116395-36116417 CATATGTCAGCTCTGGTTTGGGG + Intronic
905175816 1:36134734-36134756 TATATGTAAGCTTTGCTTTCAGG + Intergenic
909008540 1:70306139-70306161 CACATGTAAGTTATGATTACAGG + Intronic
911365558 1:96933347-96933369 CACACGTAACATCTGATTTAGGG + Intergenic
912049758 1:105512584-105512606 CACTTCTAAGCTCTTATGTCAGG + Intergenic
912090242 1:106063943-106063965 CACATTTATTCTCTTATTTCAGG + Intergenic
912151746 1:106867652-106867674 GACATTTAAGATCTGAGTTCTGG + Intergenic
913381816 1:118219574-118219596 CACATGTAACCTATGAGTTCAGG - Intergenic
915877763 1:159630459-159630481 TACACATAAGCTCTGATTTCAGG - Intergenic
916930784 1:169576252-169576274 CAATGGTAAACTCTGATTTCTGG + Intronic
918092190 1:181307222-181307244 CAATTGTAAGCTCTGTTTTTGGG + Intergenic
921418647 1:214920533-214920555 CACATCCATGCTCTGATGTCAGG - Intergenic
921640330 1:217545220-217545242 CACCTGGAATCTCTGATTTCTGG - Intronic
922871038 1:228902176-228902198 CACATGTAAGCTCTCAGCCCAGG - Intergenic
923292578 1:232560730-232560752 CACTTAGAAGCTTTGATTTCTGG - Intronic
923306319 1:232691984-232692006 CACATGTATAATTTGATTTCAGG - Intergenic
924066420 1:240227629-240227651 TAAATGTAAGAACTGATTTCTGG - Intronic
1068383649 10:56294312-56294334 CAGATTTGAGCTCTGATTTATGG + Intergenic
1068735284 10:60407281-60407303 CACCCCTAAGCTCTTATTTCTGG + Intronic
1068742505 10:60490075-60490097 TACATATGCGCTCTGATTTCAGG - Intronic
1072072340 10:91931226-91931248 TTCATGTAACCTGTGATTTCAGG - Intronic
1074566843 10:114587410-114587432 ATCATGTAAGCTCTTCTTTCAGG - Intronic
1074771255 10:116735920-116735942 CTTATGTAAGCTCTGCTTCCTGG - Intronic
1077173547 11:1178856-1178878 CACCTGTCAGCTATGGTTTCGGG + Intronic
1077509109 11:2946490-2946512 AACCTGTAACCTATGATTTCTGG + Intronic
1078113344 11:8419391-8419413 CAGATGTGAGGTCTTATTTCTGG + Intronic
1078696615 11:13639084-13639106 CAAATGTAAGCATTTATTTCTGG + Intergenic
1078879058 11:15430057-15430079 CACATATAACTTCTGGTTTCTGG - Intergenic
1083372021 11:62189881-62189903 CAAATGTGAGTTCTCATTTCAGG - Intergenic
1086313761 11:85566981-85567003 CACATGTATGGTTTTATTTCTGG + Intronic
1088357801 11:108961381-108961403 CACATCTAAGCTGGGATTTGAGG + Intergenic
1094168729 12:27468736-27468758 GACATGGAAGCTCTGAGTCCTGG + Intronic
1095433504 12:42161415-42161437 CACATTTAAGCTTGTATTTCTGG + Intronic
1101196801 12:102391888-102391910 CACCTATGAGCTCTGGTTTCTGG - Intergenic
1103344422 12:120239821-120239843 CACATGAAAGCCAGGATTTCTGG + Intronic
1105050977 12:133050502-133050524 GACTTGTAATCTCTGCTTTCAGG + Intronic
1107093108 13:36504538-36504560 AACATGGAAGCTCTGCATTCAGG - Intergenic
1109351343 13:61186314-61186336 CACATGTTATTTCTGATATCTGG - Intergenic
1110520504 13:76470428-76470450 AACATGAAAGCTCTGAACTCAGG + Intergenic
1112541995 13:100323285-100323307 CAGGTGTAAACTCAGATTTCAGG + Intronic
1113310968 13:109132369-109132391 CACATGTAAACTGTGTTTTGTGG - Intronic
1114286949 14:21253510-21253532 CACATGTAATTTTTGTTTTCAGG - Intronic
1114487305 14:23070521-23070543 CACAAGTTAGCTCCCATTTCAGG + Intronic
1117222483 14:53619922-53619944 GCAATGTATGCTCTGATTTCTGG + Intergenic
1120017248 14:79487880-79487902 TGCATGTTAGCTCTGATTTTGGG + Intronic
1120546038 14:85812612-85812634 CAGATGTAGGCACTGCTTTCAGG + Intergenic
1120936843 14:89905003-89905025 CACAAGTCAGCTTTGATTTGGGG + Intronic
1121801208 14:96775620-96775642 TTCAGGTAAGCTCTGATTTTAGG + Intergenic
1124809603 15:32921930-32921952 GACATGTAATCCCTGACTTCGGG - Intronic
1127300402 15:57647548-57647570 CCCATGTAAGTCCTGCTTTCAGG + Intronic
1129907540 15:79199293-79199315 CACATGTTCTCTCTGATTTGTGG - Intergenic
1130081666 15:80739244-80739266 CACAGGTAGGCTGTGTTTTCAGG - Intronic
1134425314 16:14136604-14136626 CACATATTAGCACTGATTTGGGG + Intronic
1135909919 16:26550731-26550753 CACATATTAGCTGTGATTTGGGG - Intergenic
1136068361 16:27773690-27773712 CACATGAAAACCCTGATCTCTGG + Intronic
1136416324 16:30106363-30106385 CAAATGAAAGCCCTGATTTGAGG - Intronic
1137334961 16:47539178-47539200 TACATGGAAGCTCTGACTCCTGG + Intronic
1139976862 16:70819036-70819058 CACAAGTAAGCTGGGATTACAGG + Intronic
1142166593 16:88593528-88593550 CACACAGAAGCTCTGCTTTCTGG - Intronic
1149114395 17:53074348-53074370 CAAATGGTAGTTCTGATTTCAGG + Intergenic
1151996553 17:77612983-77613005 GACATGGAAGCTCTGAATTTGGG - Intergenic
1153000520 18:451305-451327 TAAATATAAGCTCTAATTTCAGG - Intronic
1157672562 18:49542555-49542577 CACCTGTAATCCCTGAATTCTGG - Intergenic
1159548896 18:69874542-69874564 AACATTCAAGCTTTGATTTCAGG - Intronic
1161690412 19:5729671-5729693 CACATTTAAACTATTATTTCTGG + Intronic
1163107433 19:15133271-15133293 GACATGGAAGCTATGATTTAAGG + Intergenic
1164454675 19:28397367-28397389 CACATGGCAGCTCTGAGCTCAGG - Intergenic
1164459927 19:28437898-28437920 GAAATGAAAGCTCTGATTTCTGG - Intergenic
1164733099 19:30520539-30520561 ACCAAGTAAGCTCTAATTTCTGG + Intronic
926118616 2:10228931-10228953 ACCATGAAAGCTCTGATATCAGG + Intergenic
926337102 2:11872028-11872050 CACCTGTAAGTTCTGTTTTTTGG + Intergenic
929808289 2:45167954-45167976 CAAATGTAGGCACTGATTTTAGG - Intergenic
930018279 2:46985629-46985651 CACCTGTGAGCTCTGACTTTGGG - Intronic
931611598 2:64107188-64107210 CACCTGTAAGCTGGGATTACAGG + Intronic
932246844 2:70203351-70203373 CACATGTGGCCTCTGATCTCTGG - Intronic
932523874 2:72443383-72443405 TACATGTATGGTCTTATTTCTGG - Intronic
934636623 2:95995222-95995244 CATATGTAATATTTGATTTCTGG - Intergenic
938408858 2:131047484-131047506 CACAGGGAAGCACTGGTTTCTGG - Intergenic
938591083 2:132736831-132736853 CAAATGTAAGTTCACATTTCTGG + Intronic
941168010 2:162104219-162104241 CACATGCAAGCCTTTATTTCAGG + Intergenic
941636876 2:167944490-167944512 CACATGTAAGTTCAAATTCCAGG + Intergenic
942300794 2:174560106-174560128 CACATGTAAGCTCTGATTTCAGG + Exonic
943888752 2:193257816-193257838 CAGTTGTAAGCTATGCTTTCTGG - Intergenic
943988364 2:194653626-194653648 AAGAAGTAAGCTCTGCTTTCTGG - Intergenic
1169244059 20:4011304-4011326 GACATGTAACTTCTGAATTCAGG + Intronic
1171161016 20:22923583-22923605 CAGAATGAAGCTCTGATTTCAGG + Intergenic
1173765885 20:45609089-45609111 CTCATGTAACCTTAGATTTCAGG + Intronic
1174035169 20:47664246-47664268 CAGGTGCAAGCTGTGATTTCTGG + Intronic
1174356180 20:49999438-49999460 CCCATTTAAGCTTTTATTTCAGG - Intergenic
1181002753 22:19995554-19995576 CAAATGTCAGCTTTGGTTTCAGG - Intronic
1183870745 22:40740214-40740236 TACATGGAAGCTCTGAGTTACGG - Intergenic
1184810238 22:46826366-46826388 CACATCTTAGCTCTCATCTCTGG + Intronic
1185362339 22:50415837-50415859 CGTATGTAAGCTCTGTCTTCAGG - Intronic
949501954 3:4688457-4688479 CAGATGAAAGCACTGATTGCTGG - Intronic
950122516 3:10491144-10491166 CACAGGGAAGCTCTGACTCCGGG + Intronic
950532038 3:13557873-13557895 CAAATTTGAGCTCTGATCTCTGG + Intronic
951892040 3:27576537-27576559 CAGATGTTATCTCTGAATTCAGG + Intergenic
952386955 3:32848825-32848847 CACATGAAAGCTCAGCTTTCTGG - Intronic
955452775 3:59087748-59087770 ATCATGTAAACTCTGAATTCTGG - Intergenic
956747878 3:72323846-72323868 CACATGAAAATTCAGATTTCTGG + Intergenic
960690890 3:120345707-120345729 CACATATAAACTCTGATTGTAGG - Intronic
962504096 3:136028418-136028440 AACAGATAAGCTCTTATTTCTGG - Intronic
965545682 3:169914085-169914107 CACATGTAAACTATGAATTTTGG + Intronic
965550907 3:169964143-169964165 CACATATAACCTCAGATTTATGG - Intergenic
973696545 4:53496227-53496249 CACATGAAAGCTGTCATCTCGGG + Exonic
974490809 4:62561595-62561617 GAAATATAAGCACTGATTTCTGG + Intergenic
975169137 4:71213405-71213427 CACAAGAAAGCTCTGCTTTCAGG + Intronic
977668234 4:99665815-99665837 CACTCATAAGTTCTGATTTCAGG + Intergenic
980535268 4:134112262-134112284 TACATTCAAACTCTGATTTCTGG + Intergenic
982058607 4:151579230-151579252 CTCATGTAAACTATGGTTTCTGG + Intronic
983539406 4:168892592-168892614 CACATGCAATCACTTATTTCAGG - Intronic
987100199 5:14584296-14584318 CACATTTCAGCCATGATTTCAGG + Intronic
988363880 5:30270924-30270946 TAAATGTAAGCTCTGATTTCGGG + Intergenic
990584257 5:57195037-57195059 CATATGGCAGCTCTGATTTTAGG + Intronic
991443809 5:66679049-66679071 CACCTGTAATCTCAGACTTCAGG - Intronic
991952413 5:71959164-71959186 CACACCTCAGCTCTGATTGCAGG - Intergenic
992299066 5:75359066-75359088 CACATCTAAACTTTGTTTTCTGG + Intronic
996116596 5:119627020-119627042 CACATGAAGGCTATGACTTCAGG + Intronic
996118652 5:119646915-119646937 CACATGTAGGCTCTTATATTTGG + Intergenic
997664197 5:135615570-135615592 AATATGTAAGTTCTGGTTTCAGG - Intergenic
997880909 5:137588833-137588855 CACATGTAAGGGTTGATTTTTGG - Intronic
1003270064 6:4600732-4600754 CACATGTCCGTTGTGATTTCAGG - Intergenic
1003849160 6:10204153-10204175 CCTATGGAAGCTCTGATTTGGGG - Intronic
1004265089 6:14142314-14142336 CAGGTGTCAGCTCTGATTGCTGG + Intergenic
1004377606 6:15104297-15104319 CACATCTAAGTCCTCATTTCAGG + Intergenic
1006004328 6:30990444-30990466 CTCATGAGAGCTCTGATTTTTGG - Intergenic
1007495318 6:42256173-42256195 CAACTGTTAGCTCTGATTTTGGG + Intronic
1011408969 6:87045911-87045933 CACCTGTCAGCTCTGCTTCCAGG - Intergenic
1012742486 6:103036325-103036347 TACATGTATGGTTTGATTTCTGG + Intergenic
1013950828 6:115779722-115779744 CACATGTAAGCAGTGATTTGTGG - Intergenic
1016886858 6:148967206-148967228 CAAATGTAAGCACTGTGTTCGGG + Intronic
1020176965 7:5889809-5889831 CACCTGTAATCTCAGCTTTCAGG - Intergenic
1022130837 7:27402978-27403000 CACATATAATCTGTGACTTCAGG - Intergenic
1023198723 7:37670069-37670091 CACATGTTAGCTCTGGCTGCTGG + Intergenic
1023497200 7:40810302-40810324 CAAATGGAAGCTCTGGTTTTAGG + Intronic
1024826104 7:53391314-53391336 CACATGTAAGCGTTTATCTCTGG + Intergenic
1024845395 7:53636262-53636284 TAAATGTAAGTTCTGATTTCAGG - Intergenic
1028412442 7:90545250-90545272 CATGTGTATGCTCTGAGTTCAGG - Intronic
1028963141 7:96772080-96772102 CACCTGTAATCTCTGAATTGTGG + Intergenic
1031466865 7:122123793-122123815 CTTATGTAAGCTCTGTTTTGTGG + Intronic
1031500943 7:122515423-122515445 CATATCCAAGCTCTTATTTCAGG + Intronic
1034995622 7:155575457-155575479 GACATGGAAGCTCTGCATTCAGG + Intergenic
1036042211 8:5097964-5097986 CATATGTTAGCTCTGTTTTTAGG + Intergenic
1036427440 8:8658098-8658120 CACATGTAATCCCAGATTTTGGG - Intergenic
1036609128 8:10334646-10334668 AACATGAAAGCTCTGATCTCTGG - Intronic
1037151230 8:15637685-15637707 CACATATAAACTATGGTTTCTGG - Intronic
1048737983 8:137522838-137522860 AATATTTAAGCTTTGATTTCAGG + Intergenic
1052762823 9:32610097-32610119 CACAGGTCATCTCAGATTTCAGG - Intergenic
1053483547 9:38434430-38434452 CACATGTAAACTGTGTATTCGGG - Intergenic
1061199633 9:129129809-129129831 TACATGTAATCTCAGAATTCGGG + Intronic
1186159190 X:6758899-6758921 CACATGTAGGCTATGATTACTGG + Intergenic
1186965452 X:14781965-14781987 CAGTTGTAAGTTTTGATTTCAGG - Intergenic
1187691710 X:21875278-21875300 CACATGAAGGTTCAGATTTCTGG + Intronic
1190468995 X:50757298-50757320 CACATGTAAAGGCTTATTTCTGG + Intronic
1190981685 X:55462079-55462101 CACAGGTAAACTCTGATTCTTGG - Intergenic
1190987013 X:55511101-55511123 CACAGGTAAACTCTGATTCTTGG + Intergenic
1193574677 X:83183409-83183431 CACAAGTAGCCTCTGATGTCAGG - Intergenic
1194713848 X:97268110-97268132 AATATGCAAGATCTGATTTCTGG + Intronic
1196191712 X:112801558-112801580 CAAATGGAAGCTGTGATTGCAGG + Intronic
1196989093 X:121308111-121308133 CCCATGTAATTTGTGATTTCAGG + Intergenic
1201126103 Y:10915860-10915882 CACATCTAAGCTCTGCCTACTGG + Intergenic