ID: 942304591

View in Genome Browser
Species Human (GRCh38)
Location 2:174593779-174593801
Sequence CTTCCCCCCAGCATGTGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942304586_942304591 27 Left 942304586 2:174593729-174593751 CCTGGAGTTTCTATTTTATGACG No data
Right 942304591 2:174593779-174593801 CTTCCCCCCAGCATGTGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942304591 Original CRISPR CTTCCCCCCAGCATGTGGTC TGG Intronic
No off target data available for this crispr