ID: 942306705

View in Genome Browser
Species Human (GRCh38)
Location 2:174615271-174615293
Sequence TATTTTGTATAGGAAGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942306705_942306709 15 Left 942306705 2:174615271-174615293 CCTCCCACTTCCTATACAAAATA No data
Right 942306709 2:174615309-174615331 AAAATACAGTCAGAATTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942306705 Original CRISPR TATTTTGTATAGGAAGTGGG AGG (reversed) Intronic
No off target data available for this crispr