ID: 942307038

View in Genome Browser
Species Human (GRCh38)
Location 2:174618786-174618808
Sequence GACTCAGGACTAGCCCCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942307038_942307045 30 Left 942307038 2:174618786-174618808 CCCTGTGGGGCTAGTCCTGAGTC No data
Right 942307045 2:174618839-174618861 TAAAGCCCCTCCTATTAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942307038 Original CRISPR GACTCAGGACTAGCCCCACA GGG (reversed) Intronic
No off target data available for this crispr