ID: 942307798

View in Genome Browser
Species Human (GRCh38)
Location 2:174625573-174625595
Sequence CTGCCTCATAGGCTGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942307791_942307798 5 Left 942307791 2:174625545-174625567 CCTCTGTCAATGGGGCTCATGGG No data
Right 942307798 2:174625573-174625595 CTGCCTCATAGGCTGGTGGAGGG No data
942307785_942307798 25 Left 942307785 2:174625525-174625547 CCTCTCTGAGGCAATTTCCACCT No data
Right 942307798 2:174625573-174625595 CTGCCTCATAGGCTGGTGGAGGG No data
942307789_942307798 8 Left 942307789 2:174625542-174625564 CCACCTCTGTCAATGGGGCTCAT No data
Right 942307798 2:174625573-174625595 CTGCCTCATAGGCTGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942307798 Original CRISPR CTGCCTCATAGGCTGGTGGA GGG Intronic
No off target data available for this crispr