ID: 942308590

View in Genome Browser
Species Human (GRCh38)
Location 2:174632981-174633003
Sequence CCCAAGTGCGTGTCTCCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942308586_942308590 7 Left 942308586 2:174632951-174632973 CCAGGTACAAGAGGCCTTCCTAC No data
Right 942308590 2:174632981-174633003 CCCAAGTGCGTGTCTCCTACAGG No data
942308587_942308590 -7 Left 942308587 2:174632965-174632987 CCTTCCTACTGCAGTTCCCAAGT No data
Right 942308590 2:174632981-174633003 CCCAAGTGCGTGTCTCCTACAGG No data
942308583_942308590 27 Left 942308583 2:174632931-174632953 CCTGGGGCTCAAGGGCAGTACCA No data
Right 942308590 2:174632981-174633003 CCCAAGTGCGTGTCTCCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942308590 Original CRISPR CCCAAGTGCGTGTCTCCTAC AGG Intronic