ID: 942313984

View in Genome Browser
Species Human (GRCh38)
Location 2:174682227-174682249
Sequence GGCGAGCGGGCCGCCCGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942313971_942313984 7 Left 942313971 2:174682197-174682219 CCCCTAACGCGCGCGTCTACGCC No data
Right 942313984 2:174682227-174682249 GGCGAGCGGGCCGCCCGGGAGGG No data
942313973_942313984 5 Left 942313973 2:174682199-174682221 CCTAACGCGCGCGTCTACGCCGA No data
Right 942313984 2:174682227-174682249 GGCGAGCGGGCCGCCCGGGAGGG No data
942313972_942313984 6 Left 942313972 2:174682198-174682220 CCCTAACGCGCGCGTCTACGCCG No data
Right 942313984 2:174682227-174682249 GGCGAGCGGGCCGCCCGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942313984 Original CRISPR GGCGAGCGGGCCGCCCGGGA GGG Intronic
No off target data available for this crispr