ID: 942314996

View in Genome Browser
Species Human (GRCh38)
Location 2:174689902-174689924
Sequence TTCCCAGGAAAGTCCCATTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942314996_942314999 -10 Left 942314996 2:174689902-174689924 CCCTAATGGGACTTTCCTGGGAA No data
Right 942314999 2:174689915-174689937 TTCCTGGGAACAGGATACCATGG No data
942314996_942315002 9 Left 942314996 2:174689902-174689924 CCCTAATGGGACTTTCCTGGGAA No data
Right 942315002 2:174689934-174689956 ATGGTTCCTTCATATAAAAGAGG No data
942314996_942315005 19 Left 942314996 2:174689902-174689924 CCCTAATGGGACTTTCCTGGGAA No data
Right 942315005 2:174689944-174689966 CATATAAAAGAGGGACTGAAAGG No data
942314996_942315003 10 Left 942314996 2:174689902-174689924 CCCTAATGGGACTTTCCTGGGAA No data
Right 942315003 2:174689935-174689957 TGGTTCCTTCATATAAAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942314996 Original CRISPR TTCCCAGGAAAGTCCCATTA GGG (reversed) Intergenic
No off target data available for this crispr