ID: 942316280

View in Genome Browser
Species Human (GRCh38)
Location 2:174699363-174699385
Sequence CTGGATAATAACTCCTTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942316280_942316287 18 Left 942316280 2:174699363-174699385 CCCTCAAAGGAGTTATTATCCAG No data
Right 942316287 2:174699404-174699426 AAAACAACTGGCTGCAACCAAGG No data
942316280_942316288 19 Left 942316280 2:174699363-174699385 CCCTCAAAGGAGTTATTATCCAG No data
Right 942316288 2:174699405-174699427 AAACAACTGGCTGCAACCAAGGG No data
942316280_942316290 23 Left 942316280 2:174699363-174699385 CCCTCAAAGGAGTTATTATCCAG No data
Right 942316290 2:174699409-174699431 AACTGGCTGCAACCAAGGGGAGG No data
942316280_942316289 20 Left 942316280 2:174699363-174699385 CCCTCAAAGGAGTTATTATCCAG No data
Right 942316289 2:174699406-174699428 AACAACTGGCTGCAACCAAGGGG No data
942316280_942316291 27 Left 942316280 2:174699363-174699385 CCCTCAAAGGAGTTATTATCCAG No data
Right 942316291 2:174699413-174699435 GGCTGCAACCAAGGGGAGGCAGG No data
942316280_942316294 30 Left 942316280 2:174699363-174699385 CCCTCAAAGGAGTTATTATCCAG No data
Right 942316294 2:174699416-174699438 TGCAACCAAGGGGAGGCAGGGGG No data
942316280_942316286 6 Left 942316280 2:174699363-174699385 CCCTCAAAGGAGTTATTATCCAG No data
Right 942316286 2:174699392-174699414 TTACAAGACAAGAAAACAACTGG No data
942316280_942316292 28 Left 942316280 2:174699363-174699385 CCCTCAAAGGAGTTATTATCCAG No data
Right 942316292 2:174699414-174699436 GCTGCAACCAAGGGGAGGCAGGG No data
942316280_942316293 29 Left 942316280 2:174699363-174699385 CCCTCAAAGGAGTTATTATCCAG No data
Right 942316293 2:174699415-174699437 CTGCAACCAAGGGGAGGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942316280 Original CRISPR CTGGATAATAACTCCTTTGA GGG (reversed) Intergenic
No off target data available for this crispr