HTGT WGE

Individual CRISPR Summary

ID: 942317306

 View in Genome Browser
Species Human (GRCh38)
Location 2:174707929-174707951
Sequence TATTACTTTCAATATTGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942317306_942317314 19 Left 942317306 2:174707929-174707951 CCCATCCAATATTGAAAGTAATA No data
Right 942317314 2:174707971-174707993 ATATTAGAAACAATATCACGGGG No data
942317306_942317309 -4 Left 942317306 2:174707929-174707951 CCCATCCAATATTGAAAGTAATA No data
Right 942317309 2:174707948-174707970 AATATAGTCCTTTCACCTTCTGG No data
942317306_942317313 18 Left 942317306 2:174707929-174707951 CCCATCCAATATTGAAAGTAATA No data
Right 942317313 2:174707970-174707992 GATATTAGAAACAATATCACGGG No data
942317306_942317316 21 Left 942317306 2:174707929-174707951 CCCATCCAATATTGAAAGTAATA No data
Right 942317316 2:174707973-174707995 ATTAGAAACAATATCACGGGGGG No data
942317306_942317315 20 Left 942317306 2:174707929-174707951 CCCATCCAATATTGAAAGTAATA No data
Right 942317315 2:174707972-174707994 TATTAGAAACAATATCACGGGGG No data
942317306_942317312 17 Left 942317306 2:174707929-174707951 CCCATCCAATATTGAAAGTAATA No data
Right 942317312 2:174707969-174707991 GGATATTAGAAACAATATCACGG No data
942317306_942317318 23 Left 942317306 2:174707929-174707951 CCCATCCAATATTGAAAGTAATA No data
Right 942317318 2:174707975-174707997 TAGAAACAATATCACGGGGGGGG No data
942317306_942317317 22 Left 942317306 2:174707929-174707951 CCCATCCAATATTGAAAGTAATA No data
Right 942317317 2:174707974-174707996 TTAGAAACAATATCACGGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942317306 Original CRISPR TATTACTTTCAATATTGGAT GGG (reversed) Intergenic
No off target data available for this crispr