ID: 942317310

View in Genome Browser
Species Human (GRCh38)
Location 2:174707956-174707978
Sequence TCTAATATCCAGAAGGTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942317310_942317320 20 Left 942317310 2:174707956-174707978 CCTTTCACCTTCTGGATATTAGA No data
Right 942317320 2:174707999-174708021 TGTACACCCCCTGCAATATTGGG No data
942317310_942317312 -10 Left 942317310 2:174707956-174707978 CCTTTCACCTTCTGGATATTAGA No data
Right 942317312 2:174707969-174707991 GGATATTAGAAACAATATCACGG No data
942317310_942317313 -9 Left 942317310 2:174707956-174707978 CCTTTCACCTTCTGGATATTAGA No data
Right 942317313 2:174707970-174707992 GATATTAGAAACAATATCACGGG No data
942317310_942317314 -8 Left 942317310 2:174707956-174707978 CCTTTCACCTTCTGGATATTAGA No data
Right 942317314 2:174707971-174707993 ATATTAGAAACAATATCACGGGG No data
942317310_942317315 -7 Left 942317310 2:174707956-174707978 CCTTTCACCTTCTGGATATTAGA No data
Right 942317315 2:174707972-174707994 TATTAGAAACAATATCACGGGGG No data
942317310_942317319 19 Left 942317310 2:174707956-174707978 CCTTTCACCTTCTGGATATTAGA No data
Right 942317319 2:174707998-174708020 TTGTACACCCCCTGCAATATTGG No data
942317310_942317318 -4 Left 942317310 2:174707956-174707978 CCTTTCACCTTCTGGATATTAGA No data
Right 942317318 2:174707975-174707997 TAGAAACAATATCACGGGGGGGG No data
942317310_942317317 -5 Left 942317310 2:174707956-174707978 CCTTTCACCTTCTGGATATTAGA No data
Right 942317317 2:174707974-174707996 TTAGAAACAATATCACGGGGGGG No data
942317310_942317316 -6 Left 942317310 2:174707956-174707978 CCTTTCACCTTCTGGATATTAGA No data
Right 942317316 2:174707973-174707995 ATTAGAAACAATATCACGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942317310 Original CRISPR TCTAATATCCAGAAGGTGAA AGG (reversed) Intergenic
No off target data available for this crispr