ID: 942317312 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:174707969-174707991 |
| Sequence | GGATATTAGAAACAATATCA CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 942317307_942317312 | 16 | Left | 942317307 | 2:174707930-174707952 | CCATCCAATATTGAAAGTAATAT | No data | ||
| Right | 942317312 | 2:174707969-174707991 | GGATATTAGAAACAATATCACGG | No data | ||||
| 942317308_942317312 | 12 | Left | 942317308 | 2:174707934-174707956 | CCAATATTGAAAGTAATATAGTC | No data | ||
| Right | 942317312 | 2:174707969-174707991 | GGATATTAGAAACAATATCACGG | No data | ||||
| 942317306_942317312 | 17 | Left | 942317306 | 2:174707929-174707951 | CCCATCCAATATTGAAAGTAATA | No data | ||
| Right | 942317312 | 2:174707969-174707991 | GGATATTAGAAACAATATCACGG | No data | ||||
| 942317310_942317312 | -10 | Left | 942317310 | 2:174707956-174707978 | CCTTTCACCTTCTGGATATTAGA | No data | ||
| Right | 942317312 | 2:174707969-174707991 | GGATATTAGAAACAATATCACGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 942317312 | Original CRISPR | GGATATTAGAAACAATATCA CGG | Intergenic | ||
| No off target data available for this crispr | |||||