ID: 942317313

View in Genome Browser
Species Human (GRCh38)
Location 2:174707970-174707992
Sequence GATATTAGAAACAATATCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942317306_942317313 18 Left 942317306 2:174707929-174707951 CCCATCCAATATTGAAAGTAATA No data
Right 942317313 2:174707970-174707992 GATATTAGAAACAATATCACGGG No data
942317310_942317313 -9 Left 942317310 2:174707956-174707978 CCTTTCACCTTCTGGATATTAGA No data
Right 942317313 2:174707970-174707992 GATATTAGAAACAATATCACGGG No data
942317308_942317313 13 Left 942317308 2:174707934-174707956 CCAATATTGAAAGTAATATAGTC No data
Right 942317313 2:174707970-174707992 GATATTAGAAACAATATCACGGG No data
942317307_942317313 17 Left 942317307 2:174707930-174707952 CCATCCAATATTGAAAGTAATAT No data
Right 942317313 2:174707970-174707992 GATATTAGAAACAATATCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942317313 Original CRISPR GATATTAGAAACAATATCAC GGG Intergenic
No off target data available for this crispr