ID: 942317317 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:174707974-174707996 |
Sequence | TTAGAAACAATATCACGGGG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
942317306_942317317 | 22 | Left | 942317306 | 2:174707929-174707951 | CCCATCCAATATTGAAAGTAATA | No data | ||
Right | 942317317 | 2:174707974-174707996 | TTAGAAACAATATCACGGGGGGG | No data | ||||
942317307_942317317 | 21 | Left | 942317307 | 2:174707930-174707952 | CCATCCAATATTGAAAGTAATAT | No data | ||
Right | 942317317 | 2:174707974-174707996 | TTAGAAACAATATCACGGGGGGG | No data | ||||
942317310_942317317 | -5 | Left | 942317310 | 2:174707956-174707978 | CCTTTCACCTTCTGGATATTAGA | No data | ||
Right | 942317317 | 2:174707974-174707996 | TTAGAAACAATATCACGGGGGGG | No data | ||||
942317308_942317317 | 17 | Left | 942317308 | 2:174707934-174707956 | CCAATATTGAAAGTAATATAGTC | No data | ||
Right | 942317317 | 2:174707974-174707996 | TTAGAAACAATATCACGGGGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
942317317 | Original CRISPR | TTAGAAACAATATCACGGGG GGG | Intergenic | ||
No off target data available for this crispr |