ID: 942317317

View in Genome Browser
Species Human (GRCh38)
Location 2:174707974-174707996
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942317306_942317317 22 Left 942317306 2:174707929-174707951 CCCATCCAATATTGAAAGTAATA No data
Right 942317317 2:174707974-174707996 TTAGAAACAATATCACGGGGGGG No data
942317307_942317317 21 Left 942317307 2:174707930-174707952 CCATCCAATATTGAAAGTAATAT No data
Right 942317317 2:174707974-174707996 TTAGAAACAATATCACGGGGGGG No data
942317310_942317317 -5 Left 942317310 2:174707956-174707978 CCTTTCACCTTCTGGATATTAGA No data
Right 942317317 2:174707974-174707996 TTAGAAACAATATCACGGGGGGG No data
942317308_942317317 17 Left 942317308 2:174707934-174707956 CCAATATTGAAAGTAATATAGTC No data
Right 942317317 2:174707974-174707996 TTAGAAACAATATCACGGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr