ID: 942317320

View in Genome Browser
Species Human (GRCh38)
Location 2:174707999-174708021
Sequence TGTACACCCCCTGCAATATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942317310_942317320 20 Left 942317310 2:174707956-174707978 CCTTTCACCTTCTGGATATTAGA No data
Right 942317320 2:174707999-174708021 TGTACACCCCCTGCAATATTGGG No data
942317311_942317320 13 Left 942317311 2:174707963-174707985 CCTTCTGGATATTAGAAACAATA 0: 11
1: 135
2: 600
3: 1080
4: 1588
Right 942317320 2:174707999-174708021 TGTACACCCCCTGCAATATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942317320 Original CRISPR TGTACACCCCCTGCAATATT GGG Intergenic
No off target data available for this crispr