ID: 942319764

View in Genome Browser
Species Human (GRCh38)
Location 2:174726106-174726128
Sequence GCTAAGAGGGAGACCCTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942319759_942319764 -1 Left 942319759 2:174726084-174726106 CCTTATTGTGTTGGGCTCAGAGG No data
Right 942319764 2:174726106-174726128 GCTAAGAGGGAGACCCTGGATGG No data
942319756_942319764 20 Left 942319756 2:174726063-174726085 CCTTGGAAATACATTCTTGAGCC No data
Right 942319764 2:174726106-174726128 GCTAAGAGGGAGACCCTGGATGG No data
942319755_942319764 21 Left 942319755 2:174726062-174726084 CCCTTGGAAATACATTCTTGAGC No data
Right 942319764 2:174726106-174726128 GCTAAGAGGGAGACCCTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942319764 Original CRISPR GCTAAGAGGGAGACCCTGGA TGG Intergenic
No off target data available for this crispr